ID: 1109295421

View in Genome Browser
Species Human (GRCh38)
Location 13:60524801-60524823
Sequence AAAAAACACAATTTTCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1994
Summary {0: 1, 1: 1, 2: 11, 3: 243, 4: 1738}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109295421 Original CRISPR AAAAAACACAATTTTCGGCC AGG Intronic
900012708 1:130981-131003 AAAAAACAAAACTTGAGGCCTGG + Intergenic
900017667 1:164343-164365 AAAAAACAAAATTCCTGGCCAGG + Intergenic
900042771 1:486968-486990 AAAAAACAAAACTTGAGGCCTGG + Intergenic
900047926 1:522939-522961 AAAAAACAAAATTCCTGGCCAGG + Intergenic
900064209 1:721959-721981 AAAAAACAAAACTTGAGGCCTGG + Intergenic
900070144 1:764803-764825 AAAAAACAAAATTCCTGGCCAGG + Intergenic
900211331 1:1457297-1457319 AAAACACAGCATTTTTGGCCAGG + Intronic
900230785 1:1556135-1556157 AAAATACACAAAGTTTGGCCAGG + Intronic
900254001 1:1687442-1687464 AAAAAACAAAAAATTAGGCCGGG + Intronic
900280800 1:1866969-1866991 AAAAACCTCAATTCTAGGCCGGG + Intronic
900388838 1:2424690-2424712 AAAATACACAAAATTAGGCCGGG + Intergenic
901114542 1:6831471-6831493 AAACAAAACAATTTTCAGTCTGG - Intronic
901318802 1:8326681-8326703 AAAAAACTCTTGTTTCGGCCAGG + Intronic
901369098 1:8781060-8781082 AAAAAAAAAAATTCTCGGCCAGG + Intronic
901424922 1:9176206-9176228 AAAAATAATAATTTTAGGCCGGG - Intergenic
901578957 1:10224717-10224739 AAAAAACATAAATTGGGGCCAGG - Intronic
901679184 1:10903406-10903428 ACAAAACACTATTTTCGGCTGGG - Intergenic
901718048 1:11172573-11172595 AAAAAATACAACTTTGGGCCAGG + Intronic
901813963 1:11783540-11783562 AAAAAAAACCATCTACGGCCAGG - Intronic
901846660 1:11987332-11987354 AATAAACAAAATGTTGGGCCGGG + Intronic
902347161 1:15826785-15826807 AAAAAACACAAAAATTGGCCAGG - Intergenic
902864967 1:19271920-19271942 AAAAAACACAAAATTTGGCCAGG + Intergenic
902953953 1:19911682-19911704 AAAAAATACAATTTACTGGCCGG - Exonic
903057479 1:20646348-20646370 ATAAAAAATAACTTTCGGCCGGG + Intronic
903110415 1:21128211-21128233 AAAAAAAAAAAGTTTCGGCTGGG + Intronic
903117111 1:21187416-21187438 CAAAAACACAAATTTTGGCCAGG + Intergenic
903202750 1:21755868-21755890 AAAAAAAATAAGTTTAGGCCAGG + Intronic
903205714 1:21781119-21781141 AAAAAAAAAAAGTATCGGCCTGG + Intronic
903490714 1:23726114-23726136 AAAAAAAAAAATTTTAGGCCAGG - Intergenic
903495775 1:23766146-23766168 AAAAAATAAAATATTAGGCCAGG + Intergenic
903518650 1:23930203-23930225 AAAAGAAAAAGTTTTCGGCCGGG - Intergenic
903581549 1:24374552-24374574 AAAAAAAACACTTTCCGGCTGGG - Intronic
903706069 1:25286796-25286818 AACAAAAACAGTTTTAGGCCAGG + Intronic
903721172 1:25406606-25406628 AAAAACAACAGTTTTAGGCCAGG - Intronic
903785800 1:25860449-25860471 AAATTACAAAATTTTTGGCCGGG - Intergenic
903805425 1:26002021-26002043 AAGAAAAAGAATTTTAGGCCGGG + Intergenic
903881005 1:26509188-26509210 TAAAAATACAACTTTCGGCCGGG - Intergenic
903958670 1:27042423-27042445 TAAAAACACAAATATTGGCCCGG + Intergenic
903961401 1:27059978-27060000 AAAAAAAACAATTTCCAGGCCGG - Intergenic
903991297 1:27271930-27271952 TAAAAAAAAAATTTTAGGCCGGG - Intronic
903992414 1:27282797-27282819 AAAAAACAGGGTTTTGGGCCGGG - Intronic
904064377 1:27737554-27737576 AAAATACAAAAATCTCGGCCGGG + Intronic
904076174 1:27844296-27844318 AAAAAATAAAAATTTCAGCCAGG - Intronic
904127406 1:28250971-28250993 AAAAAAAAGAATTTTGGGTCAGG + Intergenic
904159811 1:28514766-28514788 AAAAAAAACAATCTTCCGGCTGG + Intronic
904179665 1:28657295-28657317 ATAAAAAACAATATTGGGCCAGG - Intergenic
904244045 1:29173437-29173459 AAAAAACAACTTTTTAGGCCAGG - Intronic
904297489 1:29530549-29530571 TAAAAACACATTTGTAGGCCAGG + Intergenic
904635070 1:31873681-31873703 AAAAAACACAAAAATCGGCTGGG + Intergenic
904668653 1:32144939-32144961 AAAAAAAAAAGTTTTAGGCCAGG - Intronic
904749512 1:32732748-32732770 AAAATACAAAATTAGCGGCCGGG - Intergenic
904768218 1:32866737-32866759 AAAAAAGAAAAGTTTGGGCCTGG + Intronic
904790023 1:33012734-33012756 AAAAAATACAAATATCAGCCAGG + Intronic
905064197 1:35166057-35166079 AAAAAAGAAAATTCTGGGCCAGG + Intergenic
905086277 1:35380619-35380641 TAAAAACCAATTTTTCGGCCGGG - Intronic
905130208 1:35749118-35749140 AAAGAAGAGAACTTTCGGCCAGG - Intronic
905165899 1:36083261-36083283 AAAAAATACAAAATTTGGCCAGG - Intergenic
905398651 1:37685368-37685390 AAAAAAAAGAATTTTGGGCCAGG - Intronic
905520770 1:38597768-38597790 ATAATACATAATTTTCGGCCAGG - Intergenic
905649950 1:39649632-39649654 AAGAAACATTATTTTTGGCCGGG - Intergenic
905679200 1:39855145-39855167 AAAAAAAGTTATTTTCGGCCAGG - Intronic
905689618 1:39933376-39933398 ATAAAAAACAATTTCAGGCCAGG + Intergenic
905760675 1:40554630-40554652 AAACAACAAACATTTCGGCCGGG - Intergenic
905811072 1:40913636-40913658 AATAAGAACAATTTTAGGCCAGG + Intergenic
905817565 1:40963917-40963939 AAAATACAGAATTTATGGCCAGG + Intergenic
906097916 1:43236612-43236634 AAAAAAGGCAATTTCCAGCCGGG + Intronic
906368683 1:45233757-45233779 AAATAATTCAATTTTTGGCCAGG + Intronic
906379539 1:45323656-45323678 AAAAAATACAAAATTAGGCCAGG - Intergenic
906472698 1:46144472-46144494 AAAATACTCAATCCTCGGCCAGG + Intronic
906574828 1:46879126-46879148 AAAAAATACAATATTTAGCCGGG + Intergenic
906597145 1:47088775-47088797 AAAAAATACAATATTTAGCCGGG - Intronic
906974004 1:50549482-50549504 AAAAAACAAAATTTAAGGCTGGG + Intronic
906985460 1:50678487-50678509 AAAAAATACATTTTTTGGTCAGG + Intronic
907011240 1:50965498-50965520 AAAAAAAAGAACTTTCAGCCTGG + Intronic
907013776 1:50990920-50990942 AGAAAAAACTATTTTTGGCCAGG - Intergenic
907147832 1:52252651-52252673 GTAAAACAAATTTTTCGGCCAGG - Intronic
907155685 1:52331455-52331477 AAAAAAAAAAAGTGTCGGCCGGG + Intronic
907233929 1:53027213-53027235 AAAAAACACAAAAATTGGCCTGG - Intronic
908130961 1:61075215-61075237 AAAAAAAAAAGTTTTGGGCCTGG - Intronic
908153483 1:61328712-61328734 AAAAAAAAAAATTATAGGCCGGG - Intronic
908190358 1:61696911-61696933 AAAAAAAAAAAATTTAGGCCAGG - Intronic
908281810 1:62546867-62546889 AAAAGACATAATTTTGGGCTTGG - Intronic
908695552 1:66837067-66837089 AAAAAACATAATTTTCAGCTGGG + Intronic
908887860 1:68810676-68810698 TAAAAACACAGCTGTCGGCCGGG - Intergenic
908920799 1:69189089-69189111 AAAAAAAACTATTTTCTCCCTGG - Intergenic
909500992 1:76335600-76335622 AAAAAAATCAATTTCCTGCCAGG - Intronic
909631799 1:77775827-77775849 AAAAAATACATATTTGGGCCAGG + Intergenic
909643475 1:77891779-77891801 AAAAAAGACACTTTTGGGGCTGG + Intronic
909657966 1:78051788-78051810 AAAAATCACAATTCTACGCCAGG - Intronic
909853200 1:80495584-80495606 AAAAAGCAGATTTTTGGGCCGGG - Intergenic
910254070 1:85229745-85229767 AAAAAAAAAAAATTTCGGCTGGG + Intergenic
910255444 1:85242701-85242723 AAAAAAAAGAATTCTTGGCCGGG - Intergenic
910596474 1:88986018-88986040 AAAAAATACAAATATTGGCCGGG + Intronic
910676197 1:89819514-89819536 AAAAAAAAAAATTATAGGCCGGG - Intronic
910714193 1:90212854-90212876 ATAAAAGACATTTTTAGGCCAGG - Intergenic
910789365 1:91035399-91035421 AAAATTCACTATTTTTGGCCAGG - Intergenic
911000278 1:93157827-93157849 AAAAAACAGATTTGTAGGCCGGG + Intronic
911050755 1:93669006-93669028 AAAAAAAAAAATCTTGGGCCGGG - Intronic
912039048 1:105362114-105362136 AAAAAACAATTTTTTTGGCCGGG - Intergenic
912075450 1:105869091-105869113 AAAAACCATAATTTTAGGCAGGG - Intergenic
912082163 1:105950437-105950459 AAACAAAACAATTATCAGCCAGG - Intergenic
912150240 1:106850449-106850471 AAAGAAAAAAATTTTCGCCCTGG - Intergenic
912356363 1:109057340-109057362 CAAGAACACCATTTCCGGCCGGG + Intergenic
912782827 1:112568712-112568734 CAAAAAAACAAATTTAGGCCAGG + Intronic
912922222 1:113880329-113880351 AAATAACAAGATTTTAGGCCGGG + Intronic
912929512 1:113944457-113944479 AAAAAAAACTATTATTGGCCAGG - Intronic
913572277 1:120132355-120132377 AAAAAACACACTTTTCTTCATGG + Intergenic
913966083 1:143378641-143378663 AAAAAAAAAAAGTTTTGGCCAGG - Intergenic
914060457 1:144204248-144204270 AAAAAAAAAAAGTTTTGGCCAGG - Intergenic
914118693 1:144762121-144762143 AAAAAAAAAAAGTTTTGGCCAGG + Intergenic
914293199 1:146293999-146294021 AAAAAACACATTTTTCTTCATGG + Intergenic
914349117 1:146824503-146824525 AACAAACACAGTCTTCTGCCTGG + Intergenic
914554243 1:148744782-148744804 AAAAAACACATTTTTCTTCATGG + Intergenic
914674462 1:149897827-149897849 AAAAAAAAGAATTTTGGGCCAGG + Intronic
914701278 1:150136256-150136278 AAAAAAAAAAATTTGAGGCCGGG + Intronic
914772784 1:150705228-150705250 AAAATATACAACTTTCGGCCAGG + Intronic
914833941 1:151191686-151191708 AAAAAAGACAAAATTGGGCCTGG + Intronic
915100857 1:153498880-153498902 AAAAGACACCATTTATGGCCTGG + Intergenic
915199575 1:154216942-154216964 AAAAAAAAAAATTTAAGGCCAGG - Intronic
915378925 1:155423283-155423305 TAAAAACTGCATTTTCGGCCAGG + Intronic
915494480 1:156271886-156271908 AAAAAACAACATTTTTGGCAGGG - Intronic
915506729 1:156362037-156362059 AAAAAAAAAAAATTTAGGCCGGG - Intronic
915778391 1:158517452-158517474 AAAAAACATATTCTTGGGCCGGG + Intergenic
916044035 1:160985336-160985358 AAAAAATAAAAGTTTCGGCTGGG + Intergenic
916101626 1:161397994-161398016 AAATAAAACATTTTTTGGCCAGG - Intergenic
916757428 1:167786086-167786108 TAAAAAGACTGTTTTCGGCCGGG - Intronic
916774218 1:167943202-167943224 AAAAAGACCAAATTTCGGCCAGG - Intronic
916846777 1:168659158-168659180 AAAAAACACAGTATCTGGCCAGG - Intergenic
917123609 1:171665870-171665892 TAAAAAAACAACTTTGGGCCGGG - Intergenic
917233081 1:172858915-172858937 AGAAAACACAAGTTTGGGCCAGG + Intergenic
917326240 1:173835610-173835632 AAAATTGACATTTTTCGGCCAGG + Intronic
917410901 1:174759297-174759319 AAAAAAAAGAAGTTTCAGCCAGG + Intronic
917439413 1:175053889-175053911 TAAAAACATAATATTGGGCCAGG + Intergenic
917467686 1:175296770-175296792 TAAAAACATTATTTTTGGCCTGG - Intergenic
917543504 1:175938075-175938097 TAAAAAGTCAATTTTAGGCCGGG - Intergenic
917835832 1:178940978-178941000 AAAAAACATAATTAGGGGCCAGG - Intergenic
917880263 1:179328746-179328768 TAAAAATACATTTTTGGGCCAGG + Intronic
917946094 1:179972663-179972685 TAAAAACACTCTTTTCGGCAGGG - Intronic
917949467 1:180015527-180015549 AAAATAAACAATTTCCGGCCAGG - Intronic
918165205 1:181938258-181938280 AAAAATAACAATTCTTGGCCGGG - Intergenic
918333702 1:183486569-183486591 TAAAAACACAAAAATCGGCCAGG - Intronic
918519878 1:185403959-185403981 AAAAACCCCAAGATTCGGCCGGG + Intergenic
918652460 1:186982780-186982802 AGAAAACACATTTTTGGGGCCGG + Intronic
918701116 1:187608976-187608998 AAAAAACAGTTTTTTTGGCCTGG - Intergenic
918818587 1:189224654-189224676 AAAAAGGAAATTTTTCGGCCAGG + Intergenic
918882208 1:190139151-190139173 AAAAAAAAAAATGATCGGCCCGG + Intronic
918894389 1:190320857-190320879 AACAAAATCAATTTTTGGCCAGG - Intronic
918908392 1:190530228-190530250 AAAAAAAACAATGTTAGGTCAGG - Intergenic
919033664 1:192278126-192278148 AAAACACACAAATTTCTGGCTGG + Intergenic
919089097 1:192956639-192956661 AAAAAAAAGAGTTTTAGGCCAGG + Intergenic
919089844 1:192964947-192964969 TAAAAAAAGAATTTTAGGCCTGG + Intergenic
919098716 1:193067478-193067500 AAAAAAAAAAAATTTGGGCCGGG - Intronic
919133889 1:193484486-193484508 AAAGCAAACAATTTTCGGCCAGG - Intergenic
919239630 1:194895919-194895941 AAAAATCTCAATTTTAGGCTGGG - Intergenic
919565500 1:199180559-199180581 AAAAAATCCATTTTTTGGCCAGG + Intergenic
919603094 1:199647223-199647245 AAAAAATACAATTTTGTGCCTGG - Intergenic
919679391 1:200419542-200419564 AAAAAACCCAGATTTTGGCCAGG - Intergenic
920145711 1:203859557-203859579 AAAAAAAAAAAATTTCAGCCAGG - Intergenic
920148407 1:203883279-203883301 AAAGAACACAAGTTTTAGCCTGG + Intergenic
920324224 1:205149194-205149216 AAAAAAAAAAACTTTCGGCCAGG - Intronic
920328256 1:205184275-205184297 AAAAAAAAAAATTTAGGGCCAGG + Intronic
920339382 1:205266293-205266315 ATAAAACATAATTTTGGGCCGGG + Intronic
920656231 1:207877344-207877366 AAAAAAGAAAATTCTTGGCCAGG - Intergenic
920719401 1:208373036-208373058 AAAAAAAACATTTTTAGGCAAGG - Intergenic
920773608 1:208913998-208914020 AAAAAATGCAAGTTTGGGCCGGG - Intergenic
920944515 1:210515770-210515792 AAAAAAAAGTATTTTCAGCCAGG + Intronic
921197737 1:212776109-212776131 AAAAAACACAATTTACGGGCTGG - Intronic
921284681 1:213598620-213598642 AAAATACATTATTTTAGGCCGGG + Intergenic
921468685 1:215522285-215522307 GAAAAACACAATTTCAGGCTGGG - Intergenic
921673978 1:217956802-217956824 AAAGAACAGAATGTCCGGCCGGG + Intergenic
922105514 1:222510249-222510271 AAAAAACAAAATTCCTGGCCAGG + Intergenic
922261145 1:223947471-223947493 AAAAAACAAAACTTGAGGCCTGG + Intergenic
922265849 1:223982838-223982860 AAAAAACAAAATTCCTGGCCAGG + Intergenic
922290109 1:224202845-224202867 AAAAAACACAAATATTGGCCAGG - Intergenic
922296647 1:224255485-224255507 AAACTACACCATTTTAGGCCAGG - Intronic
922319540 1:224474067-224474089 AAAAAACGAAAGTTTTGGCCAGG + Intronic
922486506 1:225977252-225977274 AAAAAATAAAACTGTCGGCCAGG + Intergenic
922511494 1:226171836-226171858 TAAAAACACATTTATTGGCCAGG - Intronic
922515182 1:226202379-226202401 AAAAAATACAAGTATGGGCCAGG - Intergenic
922523296 1:226277047-226277069 AATAAAAAAAATTTACGGCCAGG + Intronic
922735930 1:227978269-227978291 AAAAAACAAAACTTGAGGCCTGG - Intergenic
922943675 1:229491780-229491802 AAAAAAAATAATTTTAGGCCAGG + Intronic
922954830 1:229590248-229590270 AAAAAAAAGAATTTTTGGTCTGG + Intergenic
923187327 1:231586867-231586889 AAAAAACTAATTTTTAGGCCTGG + Intronic
923489446 1:234470909-234470931 TAAGAGCACAATTTTGGGCCAGG - Intronic
923567504 1:235087480-235087502 AAAAAAAAAAATTCTAGGCCAGG - Intergenic
923585349 1:235265065-235265087 AAAAAAAAAAGTTTTCGGCTGGG + Intronic
923659750 1:235947833-235947855 AAAAAAGAAAATTCTTGGCCGGG - Intergenic
923703528 1:236323019-236323041 AAAAAACACAAAATTTAGCCAGG + Intergenic
924124132 1:240832313-240832335 AAATAACACAATTCTCTTCCAGG - Intronic
924342314 1:243049650-243049672 AAAAAACAAAACTTGAGGCCTGG + Intergenic
924713794 1:246553505-246553527 AAAAAAGACAATAATCAGCCAGG + Intronic
924730222 1:246704260-246704282 TAAAAACACAATAATCAGCCAGG + Intergenic
1062868791 10:880389-880411 AAAAAAAAAAATTCTGGGCCGGG + Intronic
1063283600 10:4659497-4659519 AAAAATGGCAAGTTTCGGCCTGG - Intergenic
1063472899 10:6302673-6302695 AAAAACCACAAGTATGGGCCGGG - Intergenic
1063682047 10:8198092-8198114 AAAAAATATGATTTTGGGCCAGG + Intergenic
1063909856 10:10818735-10818757 AAAAAACACAAAAATTGGCCAGG - Intergenic
1064100816 10:12462457-12462479 AAAAAAAAAAATTCTTGGCCAGG - Intronic
1064213533 10:13380948-13380970 AAAGAACAGAATTTTTGGCCAGG + Intergenic
1064227700 10:13501849-13501871 AAAAAAAAAAATCTTAGGCCAGG + Intronic
1064353017 10:14594217-14594239 TAAAACTACAATTTTCAGCCAGG + Intronic
1064450974 10:15441917-15441939 AAAAAACACAAACATCAGCCAGG + Intergenic
1064459838 10:15523612-15523634 AAAAAATACCACTTTGGGCCAGG + Intronic
1064747079 10:18488880-18488902 AAAAAAAAAAATCTTCAGCCGGG + Intronic
1064812698 10:19219009-19219031 AATAAACACATTTTTCAGACTGG - Intronic
1064986545 10:21216358-21216380 AAAGATCACACTTTTTGGCCGGG + Intergenic
1065015089 10:21455377-21455399 AAAAAACACAAACATCCGCCGGG - Intergenic
1065883062 10:30053765-30053787 AAAAAAAAAAATTCTGGGCCAGG + Intronic
1065911710 10:30312283-30312305 AAAATACAGTATTCTCGGCCAGG + Exonic
1065975973 10:30842631-30842653 TAAAAAAAGAATTTTCGGCTGGG + Intronic
1066413814 10:35200181-35200203 AAAAAATTCAATTTTAGGCTGGG - Intronic
1066575978 10:36825224-36825246 AAAAAAACTATTTTTCGGCCGGG - Intergenic
1066728667 10:38417102-38417124 AAAAAACAAAATTCCTGGCCAGG - Intergenic
1067001245 10:42615925-42615947 CAAAAAAACAATTGTCGGCTGGG + Intronic
1067074337 10:43165633-43165655 TAAAAATAAAATTTTTGGCCAGG + Intronic
1067104012 10:43353062-43353084 AAAGAACACAAGATTAGGCCGGG - Intergenic
1067115446 10:43432335-43432357 AAAAAAAAAAATTTTAGGCCAGG - Intergenic
1067384672 10:45807695-45807717 AAAAAACACAAAGATAGGCCAGG - Intergenic
1067410058 10:46056262-46056284 AAAAAATACATTTTTAGGCCAGG + Intergenic
1067480699 10:46595608-46595630 AAAAAATACAAAATTAGGCCTGG - Intergenic
1067614040 10:47746193-47746215 AAAAAATACAAAATTAGGCCTGG + Intergenic
1068301672 10:55150464-55150486 AAAATACACAATATTTGGCGGGG - Intronic
1068522300 10:58091179-58091201 AAAAAATACAAAATTTGGCCAGG + Intergenic
1068527638 10:58148379-58148401 TAAAAACTCAATTCTTGGCCGGG - Intergenic
1068871854 10:61954061-61954083 AAAAAATATAAATTTCAGCCGGG + Intronic
1069287788 10:66737950-66737972 TAAAAGCACAAATTTTGGCCGGG - Intronic
1069358153 10:67611609-67611631 AAAAAAGACATTTCACGGCCAGG - Intronic
1069405872 10:68097948-68097970 AAAGATCTCAATTTTAGGCCGGG + Intergenic
1069435686 10:68380564-68380586 AAAACTCACAATTATGGGCCAGG + Intronic
1069440194 10:68421457-68421479 AAGAAAGACTATTTTGGGCCGGG + Intronic
1069449871 10:68508416-68508438 AAAAAAAAGAATTCTAGGCCAGG + Intronic
1069455789 10:68552727-68552749 AAAAAGCAATAGTTTCGGCCGGG - Intergenic
1069464757 10:68628467-68628489 AAATAAAACAATTTTGAGCCTGG + Intronic
1069497289 10:68917162-68917184 AAAAAACTCATTTGTTGGCCAGG + Intronic
1069516063 10:69078189-69078211 AAAAAACAGTATTTCTGGCCGGG - Intergenic
1069529046 10:69201832-69201854 AAAAAAAAGATTTTACGGCCAGG - Intronic
1069645816 10:69996252-69996274 AAACAACTCAATTTCAGGCCAGG - Intergenic
1069660729 10:70121794-70121816 AATAAAAAAAATTTTAGGCCGGG + Intronic
1069713282 10:70504229-70504251 TAAAAACACATATTTCGGCTGGG + Intronic
1069775230 10:70923295-70923317 AAAAAAAAAAAATTTAGGCCAGG - Intergenic
1069976806 10:72220353-72220375 AGAAAACATAAGTTTCAGCCAGG + Exonic
1070066197 10:73037109-73037131 ATAAAACACAATTTAGTGCCAGG + Intronic
1070077083 10:73147083-73147105 AAAAAAAACAATCTTTAGCCAGG + Intronic
1070193939 10:74139484-74139506 AAATAAAACAATTTCAGGCCGGG + Intronic
1070212977 10:74346185-74346207 AAAAAACAGAAATTTTGGCCAGG - Intronic
1070258740 10:74832827-74832849 AAAAATCACATTTTTTGGCCGGG + Intronic
1070516952 10:77217001-77217023 CAAAAACTGAATTTTTGGCCAGG + Intronic
1070615380 10:77965830-77965852 AAAAAATAAAAATTTCAGCCTGG - Intergenic
1071029121 10:81153147-81153169 AAAAAATACAAATCACGGCCGGG + Intergenic
1071269194 10:83991382-83991404 AAAAAAAAAAAATTTAGGCCAGG + Intergenic
1071629450 10:87206167-87206189 AAAAAATACAAAATTAGGCCTGG + Intergenic
1071676129 10:87658139-87658161 AAAAATAGCAATTTGCGGCCTGG - Intergenic
1071704513 10:87982576-87982598 ATAAAACACAATCTTTGTCCTGG - Intergenic
1071968714 10:90880430-90880452 AAAAAATGCAATTGTAGGCCGGG + Intronic
1071987611 10:91068304-91068326 AACACACACAGTTTTCGGCAGGG - Intergenic
1071995282 10:91142280-91142302 AAAAAAAACAACTTTTGGCCAGG + Intergenic
1072066484 10:91876518-91876540 AAAAAAAAAAATTGTTGGCCAGG + Intergenic
1072113716 10:92348191-92348213 AAAAAAAAAAATTTTTGGCCAGG + Intronic
1072128895 10:92473223-92473245 AATAAAAAGAATTTTGGGCCGGG - Intronic
1072172920 10:92884192-92884214 AGAAAACAAAACTTTAGGCCAGG - Intronic
1072235513 10:93450096-93450118 AAAAAACACAAAAATAGGCCGGG + Intronic
1072318408 10:94225375-94225397 AAAAAACTCACCTTTCGGCTGGG + Intronic
1072414070 10:95232169-95232191 AACACACACAACTTTTGGCCAGG - Intergenic
1072419721 10:95280078-95280100 AAAAAAACAAATTTTAGGCCAGG + Intronic
1072499915 10:96003749-96003771 TAAATACAGAATTTACGGCCCGG - Intronic
1072544326 10:96422830-96422852 AAAGAACAGAATTTCAGGCCGGG + Intronic
1072631302 10:97148573-97148595 AAAAAATAAAGTTTTAGGCCAGG - Intronic
1072979104 10:100084861-100084883 AAAAACAACAATTTTAGGCCAGG - Intergenic
1073028199 10:100503729-100503751 AAAAAAAAAAGTTGTCGGCCAGG - Intronic
1073091514 10:100944198-100944220 AAAAAAAAAAAGTCTCGGCCGGG + Intronic
1073232281 10:101982223-101982245 AAAAAACACAAAAATTGGCCAGG + Intronic
1073236712 10:102022873-102022895 AAAAAGAAAAAATTTCGGCCGGG - Intronic
1073274386 10:102296747-102296769 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1073389630 10:103163719-103163741 AAAAAACTCAAATGTGGGCCAGG + Intronic
1073410461 10:103337767-103337789 AAAATACAAAATTAGCGGCCGGG + Intronic
1073744395 10:106448790-106448812 AAAAAACACGATTCCTGGCCAGG - Intergenic
1073896975 10:108172772-108172794 AAAAAAAAAAATTATAGGCCGGG - Intergenic
1073963441 10:108960677-108960699 AAAAATCAGAATTTTTGGCCAGG + Intergenic
1074361037 10:112824278-112824300 GAAAAACTCAGTTTTCGGCTGGG + Intergenic
1074443751 10:113501011-113501033 AAAAAAAAAAAGTTTGGGCCAGG + Intergenic
1074466236 10:113683306-113683328 AAAAAATACTAGTTTTGGCCAGG - Intronic
1074515073 10:114159657-114159679 AAAAAAAAGAATTTTAGGCTAGG + Intronic
1074564817 10:114567893-114567915 AAAAAAGGCTACTTTCGGCCGGG + Intronic
1074586855 10:114776317-114776339 AAAAAACGTAGTTTTGGGCCGGG + Intergenic
1074740325 10:116480114-116480136 AAAAAAAATTATTTTTGGCCAGG + Intergenic
1075114628 10:119615636-119615658 AAAATACATAATTACCGGCCGGG - Intergenic
1075324684 10:121521656-121521678 AAAAAAGACAAGTGTCGGCAAGG + Intronic
1075688853 10:124382045-124382067 AAAAAAAAAAAATTTTGGCCAGG + Intergenic
1075759926 10:124848119-124848141 AAAAAAGAAAAATTTTGGCCGGG + Intergenic
1076389119 10:130084013-130084035 TAAAAATACTATTTTGGGCCAGG + Intergenic
1076393846 10:130124190-130124212 AAAAAAGAACATTTTAGGCCAGG + Intergenic
1076407130 10:130220032-130220054 TAAAAAAACAATTTGCAGCCAGG - Intergenic
1076703467 10:132287195-132287217 TAAAAAATCAATTTTTGGCCAGG + Intronic
1076785509 10:132747751-132747773 AAAAAACAGATTTATAGGCCAGG + Intronic
1076969045 11:123185-123207 AAAAAACAAAACTTGAGGCCTGG + Intergenic
1076974264 11:159535-159557 AAAAAACAAAATTCCTGGCCAGG + Intergenic
1077079349 11:717581-717603 AAAAAACACAATTCCTGGCTGGG + Intronic
1077533729 11:3109061-3109083 AAAAAACACACTTATTGACCCGG - Intronic
1077659163 11:4051634-4051656 AAAAAAGATAATTTATGGCCAGG - Intronic
1077951654 11:6965275-6965297 AAATAACACCATTTTCAACCTGG - Intronic
1078061531 11:8048699-8048721 AAAAAATACAGCTTTCAGCCAGG - Intronic
1078061954 11:8053794-8053816 AAAAACGACAATTATTGGCCGGG - Intronic
1078235956 11:9484789-9484811 AAAAAAAAAAATCTTTGGCCAGG - Intronic
1078318697 11:10313533-10313555 AAAAAAGTCAATTTCTGGCCAGG + Intronic
1078356181 11:10633368-10633390 TAAAAAGATAATTCTCGGCCGGG - Intronic
1078654025 11:13221575-13221597 AAAAAACAGTATTTTAGGCCAGG - Intergenic
1078821268 11:14884720-14884742 AAAACACATAATTTTCTACCTGG + Intronic
1079048428 11:17130507-17130529 TAAAAACACTATTTTAGGCCGGG + Intronic
1079202187 11:18385685-18385707 AAAAAAAACTATCTTGGGCCTGG - Intergenic
1079406532 11:20152169-20152191 AAAAAAAAAAAATTTAGGCCGGG + Intergenic
1079599918 11:22298679-22298701 AAAAATCACTATTTTGGGCCGGG + Intergenic
1079720327 11:23803432-23803454 AAAAAATATAATTATCAGCCGGG - Intergenic
1080493315 11:32791655-32791677 AAAAAACACTGTTCTCAGCCAGG + Intronic
1080624926 11:34020357-34020379 AAATAAAACAATTTTAGGCCAGG + Intergenic
1081790757 11:45782216-45782238 AAAAAATACCATTTATGGCCAGG - Intergenic
1081831169 11:46116666-46116688 AAAAAACAAAAATTTAGGCCGGG + Intronic
1081922398 11:46790944-46790966 AAAAACCACTGTTTTAGGCCGGG - Intronic
1081971624 11:47203047-47203069 CAAAAATACAATTTTGGGCCTGG + Intergenic
1082033766 11:47626906-47626928 GAATAACTCAGTTTTCGGCCAGG - Intronic
1082056567 11:47822549-47822571 AAGAAAAAAAATTTTTGGCCGGG - Intronic
1082176406 11:49065312-49065334 TAAAAATTCAATTTTGGGCCGGG - Intergenic
1082209473 11:49480670-49480692 AAAAAACAAAAAAATCGGCCGGG - Intergenic
1082642756 11:55685300-55685322 AAAAAACTCAATTCCAGGCCAGG - Intergenic
1083223095 11:61266242-61266264 TAAAAACAAAATTTTTGGCTGGG + Intronic
1083455098 11:62773437-62773459 AAAAAAAAAAATTGTAGGCCGGG - Intronic
1083468390 11:62864759-62864781 AAAAAAAAAAATTAGCGGCCGGG - Intronic
1083798176 11:65030490-65030512 AAAAAAAAAAATTATAGGCCAGG - Intronic
1083851732 11:65371907-65371929 AAAAAACACAAAATTTAGCCGGG - Intergenic
1083905242 11:65664836-65664858 AAAATACAGAATTCTGGGCCAGG - Intergenic
1083908361 11:65689406-65689428 ATAAAATAAAATTTTGGGCCGGG + Intergenic
1083947123 11:65930081-65930103 AAAACAAAAAATTTTAGGCCGGG + Intergenic
1084021206 11:66419418-66419440 AAAAAGGACAATTTGGGGCCAGG - Intergenic
1084162858 11:67359704-67359726 AAAAAACACAAAAATTGGCCAGG - Intronic
1084436003 11:69140416-69140438 AAAAAATACAAAATTTGGCCAGG - Intergenic
1084609966 11:70195784-70195806 AAAATACACACTTTTGGGGCTGG + Intergenic
1084643499 11:70440276-70440298 AAAAAATACAGTATTCGGGCTGG - Intergenic
1084853850 11:71967164-71967186 AAAAAACACAAATATTGGCCGGG - Intronic
1085089579 11:73699146-73699168 AAAAAACAGCATTATCGGCCTGG - Intronic
1085368677 11:75978154-75978176 AAAGAAAAGAATTTTCGACCCGG - Intronic
1086122174 11:83315607-83315629 AAAAAAAAAAATTTCAGGCCAGG - Intergenic
1086154816 11:83654013-83654035 AAAAAAAAAAATTCTTGGCCAGG - Intronic
1086519061 11:87649620-87649642 CAAAAACACAAGTTTCAGGCAGG + Intergenic
1086689305 11:89770562-89770584 TAAAAATTCAATTTTGGGCCAGG + Intergenic
1086716552 11:90069408-90069430 TAAAAATTCAATTTTGGGCCAGG - Intergenic
1086885733 11:92203345-92203367 ATAAATCACAATTTGGGGCCAGG + Intergenic
1086951287 11:92892704-92892726 AAAAAGCACAGTTTTGGGCTGGG - Exonic
1086960411 11:92974895-92974917 AAAAAATACAAAATTAGGCCGGG - Intronic
1087327651 11:96742769-96742791 AAAAATAACAATTATTGGCCAGG - Intergenic
1087492261 11:98844104-98844126 AGAAAACACGAGTTTCTGCCTGG - Intergenic
1087789283 11:102390333-102390355 AAAAGACACAACTTTAGGCCAGG - Intergenic
1087945103 11:104149831-104149853 AAAAAAATCAATTTCCGGCCAGG - Intronic
1087950253 11:104212476-104212498 ACAAAAGAAAATTTTAGGCCGGG + Intergenic
1088311056 11:108461018-108461040 AAAAAGCAGACTTTTTGGCCGGG - Intronic
1088476503 11:110245245-110245267 AAAAAACAAAAAATTTGGCCAGG - Intronic
1088496562 11:110437152-110437174 AAAAAATACAAAATTCAGCCAGG - Intronic
1088643000 11:111891667-111891689 AAAAATTAAAAGTTTCGGCCAGG - Intergenic
1089404304 11:118184731-118184753 AAAAAAAATAGTTTTAGGCCAGG - Intergenic
1089486372 11:118849445-118849467 AAAAAAAATTATTTTTGGCCAGG - Intergenic
1089486609 11:118851403-118851425 AAAAAAAAAAATTTTGGGGCTGG + Intergenic
1089543062 11:119202415-119202437 TAAAAACACACTTGTTGGCCAGG - Intergenic
1089717355 11:120374100-120374122 TAAAAATACATTTTTTGGCCGGG - Intronic
1089801889 11:121038257-121038279 AAAAAATATAATGTTCGGCCAGG - Intronic
1089985753 11:122811618-122811640 AAAAAATACAACTATGGGCCAGG - Exonic
1090009398 11:123032937-123032959 TAAAAAAAAAATTTTAGGCCAGG + Intergenic
1090296167 11:125590512-125590534 AAAAAACAAAGTTTGGGGCCGGG - Intergenic
1090299404 11:125622586-125622608 AAAAAACTCAAATCTAGGCCAGG + Exonic
1090501692 11:127267078-127267100 AAATAACACAAATGTCGGCTGGG - Intergenic
1090680120 11:129046827-129046849 AAAAAAAAAAATTCTTGGCCGGG + Intronic
1090815689 11:130293164-130293186 TAAAAAGATAATTTTAGGCCTGG + Intronic
1091248070 11:134117064-134117086 AAAAAAAACAATCCACGGCCAGG + Intronic
1091492083 12:941611-941633 AAAAATAAAAATTTTGGGCCAGG - Intronic
1091729881 12:2872840-2872862 AAAAAAGTCACTTTTCAGCCTGG + Intronic
1092127091 12:6082258-6082280 AAAGAACATATTTTTAGGCCAGG - Intronic
1092156701 12:6287197-6287219 AAAAGTCACCATTTTAGGCCAGG + Intergenic
1092200555 12:6579759-6579781 AAAAAAAAAAAATTTTGGCCAGG + Intronic
1092221740 12:6718467-6718489 AAAAAAAAAAATTTCTGGCCAGG + Intergenic
1092221796 12:6718775-6718797 AAAAAAAAAAATTTCCAGCCAGG + Intergenic
1092268322 12:7001000-7001022 AGAATACTCAATTTTCGGCCGGG - Intronic
1092802668 12:12186140-12186162 AAAAAACAAACTCTTGGGCCAGG - Intronic
1093127507 12:15348461-15348483 AAAAAAAAAAATTATAGGCCGGG + Intronic
1093169448 12:15843436-15843458 AAAAAAAAAACTTTTAGGCCTGG + Intronic
1093263395 12:16969414-16969436 AAAAAATACTATTGTCAGCCGGG - Intergenic
1093716582 12:22390226-22390248 TAAAAACATAATTAACGGCCAGG + Intronic
1093775447 12:23068439-23068461 AAAAATTACAATCTTGGGCCAGG - Intergenic
1094012533 12:25824441-25824463 TAAAAAAATAATTTTCTGCCAGG - Intergenic
1094021145 12:25915576-25915598 TAAAAACACAAAATTAGGCCAGG - Intergenic
1094189672 12:27684402-27684424 AAATAAAAGAATTTTAGGCCGGG - Intronic
1094559676 12:31540356-31540378 AGAAAAAACAATTCTAGGCCAGG + Intronic
1094657425 12:32433630-32433652 AAAAAATGCACTTTTAGGCCAGG - Intronic
1094802293 12:34050225-34050247 AAACAAAACAATTATCAGCCAGG + Intergenic
1095115456 12:38346261-38346283 AAACAAAACAATTATCAGCCAGG + Intergenic
1095304560 12:40624540-40624562 AAAAAAAAAAAATGTCGGCCGGG + Intergenic
1095867227 12:46985191-46985213 AAAGAAAAGAAATTTCGGCCGGG + Intergenic
1096074078 12:48791111-48791133 AAAAAATGAAATTTTAGGCCGGG + Intergenic
1096149588 12:49300385-49300407 AAAAAAAATTATTTTTGGCCGGG - Intergenic
1096171175 12:49471625-49471647 TTAAAACACAAATTTTGGCCAGG - Intronic
1096271789 12:50171371-50171393 AAAAAAAAAAAAATTCGGCCGGG - Intergenic
1096335117 12:50749210-50749232 AAAAAATTCAAATTTAGGCCAGG - Intergenic
1096357981 12:50958574-50958596 AAAAAAGATTATTTTAGGCCGGG - Intronic
1096364973 12:51021328-51021350 CAAAACCACAATTTCGGGCCAGG + Intronic
1096437899 12:51610678-51610700 AAACAAAACAATTATCAGCCAGG - Intronic
1096481683 12:51945990-51946012 AAAAAACACAAAAATTGGCCAGG - Intergenic
1096608412 12:52784435-52784457 AAAATAAACAAACTTCGGCCAGG + Intergenic
1096682447 12:53265410-53265432 AAAAAAAACATGTTTTGGCCAGG - Intergenic
1096935255 12:55267049-55267071 AAAAAATACATTTTGAGGCCGGG - Intergenic
1096998833 12:55858735-55858757 AAAAAAAAAAAATATCGGCCGGG - Intergenic
1097028962 12:56078389-56078411 AAAAAACAAAACATTCGGCTGGG - Intergenic
1097061060 12:56284344-56284366 AAAAAACAAACTTTGTGGCCAGG + Intronic
1097114935 12:56690022-56690044 AAAATACAAAATATTTGGCCAGG + Intergenic
1097192888 12:57228097-57228119 AAAAAACAATTTTTTTGGCCTGG + Intergenic
1097240894 12:57574565-57574587 AAAAAATCCAATTCTGGGCCGGG - Intronic
1097259223 12:57705817-57705839 AGAAAACGGAATTTTTGGCCAGG - Intronic
1097673154 12:62566143-62566165 GAAAAAAATAATTTTCAGCCAGG - Intronic
1097846216 12:64369491-64369513 AAAAAATACATTTTAAGGCCAGG - Intronic
1097857072 12:64474820-64474842 AAAAAATAACATTTTGGGCCAGG + Intronic
1097972981 12:65654496-65654518 AAAAAACACAAAAATTGGCCGGG - Intergenic
1098355145 12:69605567-69605589 AAAAATCACAATTACTGGCCGGG + Intergenic
1099069188 12:78024679-78024701 AAAAAACACAACTTCCTGGCCGG + Intronic
1099499853 12:83400706-83400728 AAAAAAATCAATTTGGGGCCGGG + Intergenic
1099588673 12:84556048-84556070 AATTAAAACTATTTTCGGCCGGG - Intergenic
1099921527 12:88962960-88962982 AAAAAAAATAAGTTTAGGCCGGG - Intergenic
1100046896 12:90393439-90393461 ATAAAAAATGATTTTCGGCCGGG + Intergenic
1100205720 12:92347061-92347083 AAAAAATACAAAATTTGGCCAGG + Intergenic
1100323460 12:93518631-93518653 AATAAAAATAATTCTCGGCCGGG - Intergenic
1100712822 12:97275945-97275967 TAAAAACACAATTCTTGTCCTGG + Intergenic
1100827679 12:98490076-98490098 AAAAAATAAAATTTTTGGCTGGG - Intronic
1100835938 12:98567236-98567258 AAAAAAAAAAATTGTAGGCCGGG + Intergenic
1100844104 12:98642443-98642465 AAAAAAAACCTTTTTGGGCCAGG - Intronic
1100845736 12:98655771-98655793 AAAAAAGAAAAATTTTGGCCAGG - Intronic
1100989766 12:100239369-100239391 AAAAAAAAAAATTATTGGCCAGG - Intronic
1101034887 12:100695461-100695483 ATAAAAAACAATTTAAGGCCGGG + Intergenic
1101151656 12:101888424-101888446 AAAAATAATACTTTTCGGCCAGG - Intronic
1101331382 12:103760554-103760576 AAATAACACCATTTTGGGCTGGG - Intronic
1101514841 12:105425147-105425169 AAAAAAAATGATTTTAGGCCCGG - Intergenic
1101597822 12:106182892-106182914 AAAAAACACAATAATTAGCCAGG + Intergenic
1101982323 12:109418109-109418131 AAACAACCCAATCTTAGGCCGGG - Intronic
1102087452 12:110154333-110154355 AAAAAAAAGTATTTTTGGCCGGG + Intronic
1102305189 12:111799460-111799482 AAAAAAAAAAATTTTTGGCCAGG - Intronic
1102367907 12:112355298-112355320 AAAAAAAAAAATTGTGGGCCAGG + Intronic
1102373081 12:112398960-112398982 AAAAAACAAAAATATAGGCCAGG + Intergenic
1102639121 12:114350935-114350957 AAGAAACACATTTGTGGGCCAGG - Intergenic
1102642912 12:114382501-114382523 AAAAAATACAAATTTAGGCTAGG + Intronic
1102978201 12:117221577-117221599 AAAAAAAACAAATTTAGGCCGGG - Intronic
1103124468 12:118409438-118409460 AAGAAACAGAATTTTAGGCCGGG - Intronic
1103275234 12:119705792-119705814 AAAAAAAAAAAATTTTGGCCAGG + Intronic
1103300487 12:119922616-119922638 GATAGACACAACTTTCGGCCGGG + Intergenic
1103313292 12:120029940-120029962 AAAAAACAAAATTCTGGGCCGGG - Intronic
1103344348 12:120239286-120239308 AAAATACAAAAATTTAGGCCAGG + Intronic
1103378812 12:120478085-120478107 AAAAAAAAAAACTTTTGGCCGGG - Intronic
1103391649 12:120578413-120578435 AAAAAATACAACTTTGGGCCGGG - Intergenic
1103399793 12:120636004-120636026 CAAAAACACAGTTCTGGGCCGGG + Intergenic
1103408323 12:120691862-120691884 AAAAAAAAAAAGATTCGGCCTGG + Intronic
1103498440 12:121381341-121381363 ACAAAAAAAAATTTTTGGCCGGG + Intronic
1103533372 12:121618002-121618024 AAAAAAAAAAAGTCTCGGCCGGG - Intergenic
1103545809 12:121700388-121700410 AAAAAACACAAATATCGTCTGGG + Intergenic
1103580374 12:121910464-121910486 AAAAATTACCATTTTAGGCCGGG + Intronic
1103582294 12:121924408-121924430 AAAAGACACAAGTCTAGGCCGGG - Intronic
1103582347 12:121924723-121924745 AAAAGACACAAGTCTAGGCCGGG - Intronic
1104116907 12:125758566-125758588 TAAAAACACAATCATCAGCCGGG - Intergenic
1104359385 12:128117591-128117613 AAAAAAAGAAGTTTTCGGCCGGG - Intergenic
1104463960 12:128975609-128975631 AAAAAACACAAAAATCAGCCTGG - Intronic
1104703635 12:130926188-130926210 ATAAAACAGAATTTTTGGCCGGG + Intergenic
1104952742 12:132449370-132449392 AAAAAATAAATTTTTCAGCCAGG - Intergenic
1104984804 12:132590664-132590686 AAAAAATACAAAATTAGGCCGGG - Intergenic
1105026879 12:132854944-132854966 AAAATACAAAATTAGCGGCCGGG + Intronic
1105030187 12:132877089-132877111 AAAAAACATTATTATCAGCCCGG - Intronic
1105030610 12:132880669-132880691 AAAAAAGTCAATTCTGGGCCAGG + Intronic
1105359237 13:19691755-19691777 CAAAAACACAAATATCAGCCGGG + Intronic
1105413472 13:20191071-20191093 AAAAAACAATATTTTAGCCCAGG + Intronic
1105475776 13:20727213-20727235 AAAAATCACTCTTTTCGGCGTGG - Intergenic
1105494506 13:20918674-20918696 AAAAAACACAAAAATCAGCCAGG + Intergenic
1105507591 13:21023676-21023698 AAAAAAAACAAACCTCGGCCGGG + Intronic
1105583553 13:21723424-21723446 GAAAAAAAAGATTTTCGGCCGGG + Intergenic
1105783857 13:23728377-23728399 TAAAAAAATAATTTTTGGCCAGG + Intergenic
1105787262 13:23761827-23761849 AAAAAACAGAAGCTTGGGCCGGG + Intronic
1105873004 13:24525359-24525381 CAAAAAAAAAATATTCGGCCAGG - Intergenic
1106189281 13:27437044-27437066 TAAAAATACAATTGTAGGCCAGG - Intronic
1106195734 13:27492418-27492440 AAAAAACAGAAATTTAGGCCAGG - Intergenic
1106272697 13:28169751-28169773 AAAAATAATAATTTTAGGCCGGG + Intronic
1106409906 13:29504398-29504420 AAAAAACACCATTTCTGTCCCGG + Exonic
1106597245 13:31156093-31156115 AAAAAAGTTAATTTTTGGCCAGG + Intronic
1106775746 13:33007786-33007808 AAAAAACACATTTTTGAGTCTGG + Intergenic
1106844702 13:33725956-33725978 AAAGAACAAAAGTTTAGGCCGGG + Intergenic
1106937985 13:34745874-34745896 AAACAAAACAATTATCAGCCAGG - Intergenic
1107160582 13:37222686-37222708 AAAAAAAAATATTTTTGGCCAGG + Intergenic
1107515034 13:41120697-41120719 ACAAAATACAACTTTTGGCCAGG - Intergenic
1107852184 13:44581235-44581257 AGAAAAAAAAATTTGCGGCCGGG + Intergenic
1107877532 13:44803963-44803985 AAAAAACACCAGATTTGGCCAGG + Intergenic
1108060495 13:46528479-46528501 TAAAATCATAATTTTAGGCCAGG + Intergenic
1108313771 13:49219447-49219469 AAAAAACACAAAATTTAGCCGGG + Intergenic
1108364556 13:49696912-49696934 AAAAAACCCCAATTTAGGCCAGG + Intergenic
1108792562 13:53989454-53989476 AAAAAACAGAATTTTTGGGTAGG + Intergenic
1109023404 13:57129320-57129342 AAAAAGAACAAATTTGGGCCGGG + Intergenic
1109215647 13:59586683-59586705 AAAAAACTCATTTTTCGCCAGGG + Intergenic
1109295421 13:60524801-60524823 AAAAAACACAATTTTCGGCCAGG + Intronic
1109315107 13:60740727-60740749 AAAAAAGAAAATTTGCAGCCTGG - Intergenic
1109687136 13:65835552-65835574 AATTAACACAATTTTAGCCCTGG - Intergenic
1109723235 13:66304282-66304304 AAAAAGCACAATTTTCTAACTGG + Exonic
1109740502 13:66548267-66548289 AAAAAACACTTTCTTAGGCCAGG + Intronic
1110313811 13:74082030-74082052 AAAGAAAAATATTTTCGGCCAGG + Intronic
1110431956 13:75434850-75434872 AACATACACAATTATAGGCCTGG + Intronic
1110510454 13:76344134-76344156 AAAGACAAGAATTTTCGGCCGGG + Intergenic
1111028217 13:82562277-82562299 AAATAATTAAATTTTCGGCCGGG - Intergenic
1111241408 13:85480604-85480626 AACAAACAAAATTTTAGGCCAGG - Intergenic
1111345609 13:86949894-86949916 AAAATACAAAATATTAGGCCGGG + Intergenic
1111427498 13:88106890-88106912 TAAGAAGACAATTTTTGGCCAGG + Intergenic
1111437027 13:88224487-88224509 AAAAAACAGAACTGTGGGCCTGG - Intergenic
1111499537 13:89098666-89098688 AAAACACACAAATGTTGGCCAGG - Intergenic
1111594443 13:90394048-90394070 AAATTACACAAAATTCGGCCAGG + Intergenic
1111936915 13:94567125-94567147 AAAAAACAAAATTATGGGCCAGG - Intergenic
1112440975 13:99424801-99424823 AAAAAAAACTGTTTTGGGCCAGG + Intergenic
1112750246 13:102575949-102575971 AGAAATAACAATTTTAGGCCTGG - Intergenic
1112934793 13:104783870-104783892 AAAAAAAAGAATTTTCTGGCTGG - Intergenic
1113295173 13:108951805-108951827 AAAAAATACAACTATCGGCCTGG + Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114322428 14:21558321-21558343 AAAAAAAAAAAAATTCGGCCGGG - Intergenic
1114487829 14:23074131-23074153 AAAAAAAGAAATTTTCGGCCGGG - Intronic
1115259884 14:31441040-31441062 AAAAAATACAAAATTAGGCCAGG + Intronic
1115279824 14:31649102-31649124 AAAAAACAAAACTTGGGGCCAGG - Intronic
1115355565 14:32443098-32443120 AAAAAACCCATTGTCCGGCCAGG + Intronic
1115553904 14:34528838-34528860 CAAAAAAACAATTGTCGGGCTGG + Intronic
1115555724 14:34543730-34543752 AAAAAAAAAAATTCTGGGCCGGG - Intergenic
1115558184 14:34559363-34559385 AAAAAAAAAAATTCTGGGCCGGG + Intergenic
1115605182 14:34993988-34994010 AAAAAAATAAATTTTGGGCCAGG - Intronic
1115637708 14:35306406-35306428 AAAAAAGAAAAATTTGGGCCAGG + Intronic
1115677688 14:35697640-35697662 AAAAAACAAAACTGTTGGCCAGG - Intronic
1115777954 14:36736884-36736906 AAAAGACACATTTTTGGCCCAGG + Intronic
1115985172 14:39097787-39097809 AGAAAAGACTATTTTGGGCCGGG + Intronic
1116265412 14:42682639-42682661 AGAAAAGAAAATTTGCGGCCTGG - Intergenic
1116563186 14:46410206-46410228 AAAACATAGAAATTTCGGCCAGG + Intergenic
1116819447 14:49613509-49613531 AAAAAAAAAAAGTTTAGGCCAGG + Intronic
1116836489 14:49773422-49773444 AAAAAAAAAAATTTAAGGCCAGG + Intronic
1116852182 14:49919456-49919478 AAAAAACACAAATATGGGCCGGG + Intergenic
1116975020 14:51106189-51106211 AAAAATAATAATTTTAGGCCGGG - Intergenic
1117695394 14:58356992-58357014 AAAAAATCCAAATTTAGGCCGGG - Intronic
1117722652 14:58642531-58642553 TAAAAACACAAAAATCGGCCGGG + Intronic
1118134761 14:63011185-63011207 CAAGAATACAGTTTTCGGCCCGG + Intronic
1118265074 14:64287010-64287032 AAAAAAAACAACTTCAGGCCAGG - Intronic
1118349596 14:64964226-64964248 AAATAACCCACTTTTAGGCCGGG + Intronic
1118646923 14:67849576-67849598 AGAAAAAACAATTTTAGGCCAGG - Intronic
1118866792 14:69710726-69710748 AAAAAACTCAATGTTCAGCCTGG - Intronic
1119233658 14:73001682-73001704 AAATAATACAAATTTCGGCTGGG + Intronic
1119359651 14:74037656-74037678 AAAAGTAATAATTTTCGGCCAGG + Intronic
1119392568 14:74301147-74301169 AAAAAAAAAGATTTTAGGCCAGG - Intronic
1119396623 14:74330902-74330924 ATAAAACACAAGTCTGGGCCGGG + Intronic
1119581787 14:75790798-75790820 AAAAAATACCATTTTGGGGCCGG + Intronic
1119610481 14:76057524-76057546 AAAAAATAAAAATTTCAGCCAGG - Intronic
1119819022 14:77597826-77597848 AAAAAAAAGAATTTTAGGCCAGG + Intronic
1120114066 14:80593249-80593271 AAAAAACCCTGTTGTCGGCCGGG + Intronic
1120324076 14:83003278-83003300 AAAAAATAATATTTTCGGCCGGG - Intergenic
1120419782 14:84269265-84269287 AATAAATACAATTTCAGGCCGGG + Intergenic
1120731949 14:88013569-88013591 AAAAAACAAAATATTGAGCCGGG + Exonic
1121096033 14:91218696-91218718 AAAAATCCCCATTTTAGGCCAGG - Intronic
1121264691 14:92592967-92592989 AAAAAAAACAAATTTTGGCTGGG - Intronic
1121297629 14:92842466-92842488 GAAAAATACCATTTTGGGCCAGG + Intergenic
1121628288 14:95403575-95403597 AATAAATAAAATTTTTGGCCAGG + Intergenic
1121651214 14:95560317-95560339 AAACAACAGAAATTTTGGCCGGG + Intergenic
1121768390 14:96507568-96507590 TTAAAAAACTATTTTCGGCCAGG - Intronic
1122488942 14:102100401-102100423 AAAAAACAAAATTTCCAGTCTGG + Intronic
1122526727 14:102391353-102391375 AAAAACCATAGTTTTAGGCCTGG - Intronic
1122530945 14:102426552-102426574 AAAATAAACAGTTTTCAGCCAGG + Intronic
1122544314 14:102513743-102513765 TAAAAACACAAAATTAGGCCTGG + Intergenic
1122556321 14:102582513-102582535 AAAAAAAAAAATTATAGGCCGGG - Intergenic
1122564011 14:102638639-102638661 AAAAAACACTACTATAGGCCAGG - Intronic
1122657576 14:103272779-103272801 AAGAAAAGCAATTTTTGGCCGGG + Intergenic
1122911527 14:104830791-104830813 AAGAAAAACTATTCTCGGCCGGG - Intergenic
1123773914 15:23557682-23557704 TAAAAAAATAATTTCCGGCCGGG - Intergenic
1123801056 15:23821218-23821240 AAAATACAAAATATTAGGCCAGG - Intergenic
1124426225 15:29565666-29565688 AAAAGAAACATTTTCCGGCCGGG + Intronic
1124464899 15:29928646-29928668 AAAACACACACTTGTCGGCCGGG + Intronic
1124472792 15:30003099-30003121 GAAATGCAAAATTTTCGGCCGGG - Intergenic
1124501260 15:30228369-30228391 GAAAAAGACAATTTTCAGCCGGG + Intergenic
1124669643 15:31626869-31626891 AAAAAAAACAAATATAGGCCGGG - Intronic
1124742308 15:32310298-32310320 GAAAAAGACAATTTTCAGCCGGG - Intergenic
1124908441 15:33894523-33894545 AAAAAAAAAAATCATCGGCCGGG + Intronic
1124968688 15:34462706-34462728 AAAAAAAACAATTATTGGCCAGG + Intergenic
1125031371 15:35079189-35079211 AAAAATCACAGATTTAGGCCGGG - Intergenic
1125134318 15:36324129-36324151 AAAAAAAACAAGTTTCCTCCAGG + Intergenic
1125139267 15:36385281-36385303 AAAAAATATAGATTTCGGCCAGG + Intergenic
1125147279 15:36486290-36486312 AAGAAACACAGCTTCCGGCCTGG - Intergenic
1125466087 15:39954245-39954267 AAAAAGAACAATTTTAGTCCAGG - Intronic
1125572406 15:40730815-40730837 AAAAAAGAAAAATTTAGGCCGGG - Intronic
1125971697 15:43917073-43917095 TAATAATACAATTTTCCGCCAGG - Intronic
1126152693 15:45537491-45537513 AAAAATAATAATTTTAGGCCAGG + Intergenic
1126630374 15:50728801-50728823 AAAAAATACAATAATCAGCCAGG - Intronic
1126649325 15:50905953-50905975 AAAATACAAAATATTCGGACAGG - Intergenic
1126676645 15:51164392-51164414 AAAAAACTCTTTTTTTGGCCAGG - Intergenic
1126774044 15:52084500-52084522 AAAAAAAAGAATCTTGGGCCAGG + Intergenic
1126816827 15:52461966-52461988 AAAAAAAAAAAGTTTGGGCCAGG + Intronic
1127075173 15:55318541-55318563 AAAAAACACAAAAATTGGCCAGG + Intronic
1127086205 15:55426713-55426735 AAACAACTAAATTTTGGGCCAGG - Intronic
1127134615 15:55906798-55906820 AAAAAATAAAATTTTAGGCTGGG + Intronic
1127168504 15:56273238-56273260 AAAAAATACACAATTCGGCCGGG - Intronic
1127236813 15:57062249-57062271 AAAAAACACTGTTACCGGCCGGG - Intronic
1127421160 15:58807656-58807678 AATAAAGACTATTTTAGGCCGGG - Intronic
1127444945 15:59051478-59051500 AAAAAAGACAAATTTTGGCTGGG + Intronic
1127636544 15:60876240-60876262 AAAAAACACATTTTTTGGTTGGG - Intronic
1127736181 15:61841036-61841058 GAAAAACACAAAAATCGGCCGGG - Intergenic
1127987746 15:64087384-64087406 AAAAAATACAAAATTAGGCCGGG - Intronic
1128029092 15:64463407-64463429 AAAAAAAAAAATTTGGGGCCTGG + Intronic
1128057775 15:64713363-64713385 AAATGACAAAATTTTCGACCGGG + Intergenic
1128125283 15:65187705-65187727 AAAAATCTCACTTCTCGGCCAGG + Intergenic
1128154006 15:65380747-65380769 AAAAACCACCATTTTGAGCCGGG + Intergenic
1128167461 15:65478553-65478575 AAAAAAAACTATTTTTGGCTGGG - Intronic
1128195329 15:65748692-65748714 TAAAAACCCAATTGTTGGCCAGG + Intronic
1128201080 15:65808704-65808726 AAAAAATATATTTTTAGGCCAGG - Intronic
1128272091 15:66319232-66319254 AAAAAACAGAATCTTGGGGCTGG - Intronic
1128364886 15:66992284-66992306 AAAAAACCAACTTTTCGGCTGGG - Intergenic
1128581293 15:68812022-68812044 AAAAAAAACAACTTAGGGCCAGG - Intronic
1128678014 15:69625999-69626021 ATAAAAGAAAATTTTAGGCCAGG - Intergenic
1128840716 15:70849061-70849083 AAAAAACATATTTCTTGGCCGGG + Intronic
1128928690 15:71683080-71683102 AAAAAATACAAAAATCGGCCAGG - Intronic
1128962473 15:72022224-72022246 AAAAATCAAATTTTTTGGCCAGG + Intronic
1129218259 15:74114460-74114482 GAAAGATACAATTTTAGGCCGGG + Intronic
1129406092 15:75319119-75319141 GAAAGATACAATTTTAGGCCGGG - Intergenic
1129423391 15:75448202-75448224 AAAAAAGACATTATGCGGCCGGG + Intronic
1129524875 15:76207414-76207436 AAAAAACACAAAATTTAGCCAGG - Intronic
1129761716 15:78132570-78132592 AAAAAATACAATAATTGGCCGGG - Intronic
1129864504 15:78894701-78894723 AAAATACATGATTTTAGGCCGGG - Intronic
1129972622 15:79793179-79793201 AAAAAAATAAATTTTAGGCCAGG - Intergenic
1130545038 15:84850542-84850564 AAAAAACAAAATATTTAGCCAGG - Intronic
1130558610 15:84941498-84941520 AAAAAAAACAAATCCCGGCCGGG - Intronic
1130818933 15:87472269-87472291 AAAAAATACAATTTTTGATCAGG + Intergenic
1131040894 15:89265815-89265837 AAAAAACAAAAAATCCGGCCAGG - Intronic
1131384052 15:91988032-91988054 ATAAAACACAATTATCTGTCAGG - Intronic
1131541574 15:93279498-93279520 AGAAAACACACTTCACGGCCAGG - Intergenic
1131632439 15:94193569-94193591 AAAAAACAAAATCTGCGGCCCGG + Intergenic
1131992098 15:98102474-98102496 AAAAAAAAGAACTTTTGGCCTGG - Intergenic
1132160776 15:99539813-99539835 AAAAAGCAAAAATATCGGCCGGG + Intergenic
1132413279 15:101602052-101602074 AAAAAATCAAATTTTAGGCCAGG + Intergenic
1132494138 16:252475-252497 TAAAAACAGACTTTCCGGCCGGG - Intronic
1132531026 16:449654-449676 AAAAAAAAAAGTTTTAGGCCGGG + Intronic
1132610852 16:815620-815642 AAAAAATACATTTTTTGGCTGGG - Intergenic
1132812090 16:1805079-1805101 AAACAACACAAGTTTAGGCCAGG - Intronic
1132935767 16:2480123-2480145 AAAAAAAACAATTAACGACCAGG - Intronic
1133058023 16:3157111-3157133 AAAAAATACAAATTTTCGCCAGG - Intergenic
1133137802 16:3724233-3724255 AAAAAAAAAAATATTCAGCCGGG - Intergenic
1133167115 16:3955842-3955864 AAAAAACCTAAATTTTGGCCAGG - Intronic
1133193412 16:4151317-4151339 AAAAATCACAGCTTTTGGCCAGG + Intergenic
1133196326 16:4173364-4173386 AAAAAAAAAAATTTGAGGCCGGG - Intergenic
1133213242 16:4274415-4274437 AAAAAAAAAAACTTTCGGCTGGG + Intergenic
1133470711 16:6072603-6072625 AAAAAAAACAATTGTTGGCCTGG - Intronic
1133943617 16:10330338-10330360 AAAAAAAAAAATTTCAGGCCGGG - Intronic
1133955485 16:10439827-10439849 AAAAATCTCAAACTTCGGCCGGG - Intronic
1133988095 16:10683749-10683771 AAAAAACACAAAAATCAGCCGGG - Intronic
1133995938 16:10748244-10748266 AAAAATTGCAATTTTAGGCCAGG - Intronic
1134119694 16:11575096-11575118 AAAAAAAAGAACTTTAGGCCGGG - Intronic
1134482930 16:14633946-14633968 ATAAAAGACAATTCTCGGCCGGG - Intronic
1134598678 16:15516126-15516148 AAAAAGCACAAATTAAGGCCAGG + Intronic
1134602143 16:15541895-15541917 AAAAAAAAAAAATTTAGGCCGGG - Intronic
1135013296 16:18903118-18903140 AAAAAACAAAATTTATGGCCGGG - Intronic
1135017569 16:18936594-18936616 AAAAAACACAAAAATTGGCCAGG - Intergenic
1135095920 16:19564692-19564714 TAAAAACAAACTTTTTGGCCAGG - Intronic
1135173179 16:20204545-20204567 AAAAAATACAAATTCTGGCCAGG + Intergenic
1135264476 16:21010874-21010896 AAAAAAAACAGGTTTTGGCCGGG - Intronic
1135320226 16:21490714-21490736 AAAAAACAAAATTTATGGCCGGG - Intergenic
1135362652 16:21828410-21828432 AAAAAACGGAAATTTTGGCCAGG + Intergenic
1135373061 16:21922204-21922226 AAAAAACAAAATTTATGGCCGGG - Intergenic
1135419377 16:22295063-22295085 CAAAAACATAATGTTGGGCCTGG + Intergenic
1135438728 16:22448498-22448520 AAAAAACAAAATTTATGGCCGGG + Intergenic
1135574494 16:23574941-23574963 AAAAAATACAGATATCGGCCAGG + Intergenic
1135697347 16:24601490-24601512 AAAAAAAACCATTTAGGGCCAGG - Intergenic
1135717917 16:24788941-24788963 AAATAAAAGAATTTTGGGCCGGG - Intronic
1135797685 16:25461018-25461040 AAAAAATACAATTATTAGCCGGG - Intergenic
1135883683 16:26284280-26284302 AAGAAACACTAATTCCGGCCAGG + Intergenic
1135983979 16:27170114-27170136 AAAAAACACAAAAATTGGCCAGG + Intergenic
1136102768 16:28007809-28007831 AAACAACACAAATTTAGGCTGGG - Intronic
1136149339 16:28336628-28336650 AAAAAACGGAAATTTTGGCCAGG + Intergenic
1136330453 16:29572412-29572434 AAAAAACAAAATTTATGGCCGGG - Intergenic
1136424527 16:30160667-30160689 AAAAAACATATTTTTGGGCCGGG + Intergenic
1136445081 16:30312132-30312154 AAAAAACAAAATTTATGGCCGGG - Intergenic
1136447006 16:30328352-30328374 AAAAAAAAAAATTTATGGCCGGG + Intergenic
1136562919 16:31051424-31051446 AAAGAACATAATGTTTGGCCAGG + Intergenic
1136690224 16:32023536-32023558 AAAAAAAACAGTTCTCGGCTTGG - Intergenic
1137242057 16:46664004-46664026 AGAAAAAACAATTATCAGCCAGG - Intronic
1137625710 16:49906947-49906969 AGAAAAGACAATGTTCGGCCGGG + Intergenic
1137640761 16:50026677-50026699 AAAAAACATATTTTTTGGCCAGG + Intronic
1137644454 16:50061996-50062018 AAAAAATAAAGTCTTCGGCCAGG - Intergenic
1137790858 16:51173489-51173511 AAAAAATACCTTTTCCGGCCGGG + Intergenic
1137935197 16:52628437-52628459 AAAAAAAAAAAATTTTGGCCAGG + Intergenic
1138218865 16:55232834-55232856 AAAAAAGTCAATTCCCGGCCAGG + Intergenic
1138411350 16:56842847-56842869 AAAAAACACTATTGTGGGGCCGG - Intronic
1138609604 16:58112088-58112110 AAAAAACAATGTTTTTGGCCAGG - Intergenic
1138649826 16:58453489-58453511 AAAAATCACATTTGTGGGCCGGG + Intergenic
1138661136 16:58517769-58517791 TAAAAACGAAATTTTCGGCCAGG - Intronic
1138949756 16:61898004-61898026 TAAAGAAACAATTTTGGGCCAGG + Intronic
1139016507 16:62696027-62696049 AAAAAAAAAAAGTTTTGGCCGGG - Intergenic
1139403820 16:66702771-66702793 AAAAAACAAACTTTGCGGCTGGG + Intergenic
1139454741 16:67064499-67064521 TAAAAACATAATTTTAGGGCTGG - Intronic
1139530682 16:67541222-67541244 AAAAAAAAAAATTTTTAGCCAGG - Intronic
1139542340 16:67627651-67627673 AAAAAACACGAAGGTCGGCCGGG + Intronic
1139613228 16:68073742-68073764 AAAAAAGAAAATTATCGGCTGGG - Intronic
1139698766 16:68694324-68694346 AAAAAAAAAAAATTCCGGCCAGG + Intronic
1139808518 16:69591225-69591247 AGAAAATACAATTTGTGGCCAGG - Intronic
1139812188 16:69630181-69630203 AAAAAACACAAAAATCAGCCAGG - Intronic
1139873713 16:70128207-70128229 AAAAAAGACAGTTTTGGGCAGGG - Intronic
1139907131 16:70374019-70374041 AAAAAAAAAAATGTTCGGCCAGG - Intergenic
1139909197 16:70386630-70386652 AAAAATAAAAATTTTTGGCCGGG - Intronic
1139984917 16:70891051-70891073 AACAAACACAGTCTTCTGCCTGG - Intronic
1140098083 16:71892561-71892583 AAAAAAAAAAAATTTTGGCCGGG - Intronic
1140171229 16:72607231-72607253 CAAAAACTGAATTTTTGGCCAGG + Intergenic
1140358732 16:74327397-74327419 AAAAAATAGAATTATCGGCCGGG + Intergenic
1140383484 16:74512280-74512302 AAAAAAAAAAATTTTTGCCCAGG + Intronic
1140402539 16:74683298-74683320 AAAAAAAAAAATGTTCTGCCAGG + Intronic
1140524946 16:75614927-75614949 AAAAATCTCAATTACCGGCCAGG + Intronic
1140531512 16:75670790-75670812 AAAAAATAAAATTTTACGCCTGG - Intronic
1141060351 16:80861416-80861438 AAAAAACACAAAAATTGGCCAGG + Intergenic
1141145265 16:81524954-81524976 TAAAAATACAATTATCAGCCAGG - Intronic
1141583411 16:85016315-85016337 CAAAAATAAAATTTTTGGCCAGG - Intergenic
1141956835 16:87377860-87377882 AAAAAACAGAAATCTAGGCCAGG + Intronic
1142374269 16:89698780-89698802 AAAAAAAAAAATTCTAGGCCGGG - Intronic
1142445996 16:90138114-90138136 AAAAAACAAAATTCCTGGCCAGG - Intergenic
1142451631 16:90175937-90175959 AAAAAACAAAACTTGAGGCCTGG - Intergenic
1142461512 17:97349-97371 AAAAAACAAAATTCCTGGCCAGG + Intergenic
1142532151 17:587357-587379 ATAAAATACAATTTTCTGGCTGG - Intronic
1142579358 17:931846-931868 AAAAAAAAAAATTTTTGGCCGGG + Intronic
1142581184 17:943940-943962 AAAAATAACAATATTTGGCCGGG + Intronic
1142726330 17:1817331-1817353 AAAAAAAACAGTTTTAGGCCAGG - Intronic
1142795870 17:2306419-2306441 AAAAACAACAATTTTAGGCCAGG + Intronic
1142798318 17:2326807-2326829 AAAAAGAAAAATTTTTGGCCGGG + Intronic
1142891507 17:2947048-2947070 TTAAAACACAGTTTCCGGCCGGG - Intronic
1143077998 17:4361641-4361663 AAAAGACACATTTGTCAGCCAGG + Intronic
1143195592 17:5074030-5074052 AAAACACACATTTCTGGGCCGGG + Intergenic
1143199365 17:5101317-5101339 AAAAAATACAAATATCAGCCAGG + Intergenic
1143323247 17:6081358-6081380 AAAAAAAAAAATTGTTGGCCAGG - Intronic
1143569085 17:7743368-7743390 AAACAAAACAATGATCGGCCAGG + Intronic
1143581319 17:7828737-7828759 AAATTACAGAATTTTAGGCCAGG - Intronic
1143820913 17:9562106-9562128 AAAAAAAAAAACTTTCGGCCGGG + Intronic
1143900100 17:10167857-10167879 AAAAAATACAAATGTCAGCCAGG - Intronic
1144165619 17:12607425-12607447 AAAAAACAGATTTTGTGGCCCGG - Intergenic
1144252809 17:13436959-13436981 AAAAAACAAGATTCTTGGCCAGG + Intergenic
1144478682 17:15611315-15611337 AGAAAACACATTTCTGGGCCAGG - Intronic
1144817771 17:18048194-18048216 AAAAAAAAAAGTTATCGGCCAGG - Intronic
1144919617 17:18752417-18752439 AGAAAACACATTTCTGGGCCAGG + Intronic
1145001134 17:19305421-19305443 AAAAAACACAAATGTAGGCTAGG - Intronic
1145053461 17:19682068-19682090 AAATAACATAAATTTGGGCCGGG + Intronic
1145079242 17:19880982-19881004 AAAAAAAAAAAATTTTGGCCAGG + Intergenic
1145127990 17:20317552-20317574 AAAAAACAAAATTTTGGGCCAGG - Intronic
1145292233 17:21557221-21557243 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1145855491 17:28152976-28152998 TAAAAGCTCAAGTTTCGGCCAGG + Intronic
1145938368 17:28727914-28727936 GAAAAACTCAGTATTCGGCCAGG - Intronic
1145951779 17:28824170-28824192 AAAAAAAAAAATTCTCGGCCGGG - Intronic
1145981676 17:29016159-29016181 AAAAAATACAAATATAGGCCGGG - Intronic
1146035777 17:29405481-29405503 AAAGACCACAAGTTTAGGCCAGG + Intronic
1146186556 17:30728115-30728137 AAAAAACAAAAAATTTGGCCGGG + Intergenic
1146188705 17:30746193-30746215 AAAAAACACAAAAATCAGCCAGG + Intergenic
1146220010 17:31009543-31009565 TAAAAACACACTTTTTGGCGGGG + Intergenic
1146282159 17:31551629-31551651 AGAAAACCCAATGTTTGGCCGGG - Intergenic
1146333596 17:31950521-31950543 AAAAAACACAAAAATCAGCCAGG + Intronic
1146876208 17:36413657-36413679 AATAAAAATAATTTTAGGCCAGG - Intronic
1147001226 17:37363825-37363847 AAAATACAAAATTTGCGGCAGGG + Intronic
1147063175 17:37899216-37899238 AATAAAAATAATTTTAGGCCAGG + Intergenic
1147404389 17:40200490-40200512 AAAAAAAAAAAATTTAGGCCGGG + Intergenic
1147411434 17:40255618-40255640 AAAAAAAAAAAATTTAGGCCGGG - Intronic
1147485369 17:40807379-40807401 AAAAAACACAAAATTTAGCCAGG - Intergenic
1147502070 17:40975065-40975087 AAAAAAAAAAACTGTCGGCCAGG - Intergenic
1147667025 17:42155238-42155260 AAAAAAAAAAAGTTCCGGCCGGG - Intergenic
1147866095 17:43553455-43553477 AAAATACAAAAATTACGGCCGGG - Intronic
1148005234 17:44422483-44422505 AAAAAAAAAAATTTTAGGCTAGG - Intronic
1148013053 17:44501122-44501144 AAAAACCAACATTTTCGGCCAGG + Intronic
1148044262 17:44732868-44732890 AAAAAAAAAAAAATTCGGCCAGG + Intronic
1148055418 17:44791728-44791750 AAAAAAAAAAAATTTAGGCCGGG - Intergenic
1148145119 17:45359849-45359871 TAAAAACATTATTTTTGGCCGGG + Intergenic
1148154877 17:45417756-45417778 AAAAAAAAAAAATTTTGGCCGGG + Intronic
1148179111 17:45590847-45590869 AAAAAAAACAATTTGGGGGCTGG + Intergenic
1148413114 17:47484773-47484795 AAAAAAAAGAAGTTACGGCCGGG + Intergenic
1148521478 17:48280170-48280192 ATAAAATACAATTCTTGGCCAGG + Intronic
1148585342 17:48774457-48774479 AAAAAACTAGATTTTGGGCCGGG - Intronic
1148603846 17:48913646-48913668 AAAAAACAGATTTCTGGGCCGGG - Intronic
1148727408 17:49803717-49803739 TAAAAATGCAATTTTAGGCCGGG - Intronic
1148823416 17:50374554-50374576 AAAAAGAACAGTTTTTGGCCAGG + Intronic
1149105886 17:52964285-52964307 AAAAAATTCAATTCTCAGCCAGG + Intergenic
1149278009 17:55066517-55066539 AAAAATTACAATTTTTGGCCAGG - Intronic
1149509289 17:57225190-57225212 AAAAAAGAAAAATTTCGGCCAGG - Intergenic
1149587029 17:57797440-57797462 AAACAATAGAATTTTGGGCCAGG + Intergenic
1149672683 17:58429548-58429570 AAAAAACTAAATGTTTGGCCAGG + Intronic
1149693883 17:58601088-58601110 AAAAAAAACTTTTTTAGGCCAGG + Intronic
1149782874 17:59411979-59412001 AAATAACATAATTTTGGGTCAGG - Intergenic
1149875866 17:60232466-60232488 AAAAAAAAAAAATTTGGGCCAGG - Intronic
1149917280 17:60621890-60621912 AAAAAAAAAAATTATCGGCCAGG + Intronic
1149921324 17:60662290-60662312 AAAGATCTCAATTTTTGGCCGGG - Intronic
1150011351 17:61507290-61507312 CAAGAACAAAATTTTAGGCCAGG - Intergenic
1150412015 17:64953201-64953223 TCAAAACAAAATTTTTGGCCAGG + Intergenic
1150420704 17:65032813-65032835 AAAAAACACAGTATTAGGCTGGG + Intronic
1150435854 17:65153594-65153616 AAAAAACTTTATTTTTGGCCAGG + Intronic
1150892028 17:69163130-69163152 AAAAAATATAAATTTTGGCCAGG - Intronic
1150911525 17:69392693-69392715 AAAATACTCAATTTTCGGCTGGG + Intergenic
1151120768 17:71790142-71790164 AAAAAATAAAACTTTTGGCCAGG - Intergenic
1151128902 17:71875518-71875540 AAAATAAACAATTTTTGGCTGGG + Intergenic
1151667676 17:75554893-75554915 AAAAAAAAAAATTTTTGGCTGGG + Intronic
1151689921 17:75677094-75677116 AAAAAAAAAAGTTTTCTGCCAGG - Intronic
1151707936 17:75781251-75781273 AAAAAAAAAAATTACCGGCCAGG - Intronic
1151811988 17:76449621-76449643 AAAAAAAATAAGTTTCGGGCGGG + Intronic
1152171714 17:78754641-78754663 AAAAATCACAATTTTGGGCTGGG - Intronic
1152496033 17:80672490-80672512 AAAAAACAAACTTCTCAGCCAGG + Intronic
1153128652 18:1828540-1828562 TAAAAACAAAATTTTTAGCCTGG + Intergenic
1153205525 18:2695603-2695625 TAAAAAAAAAATTTTAGGCCGGG - Intronic
1154242738 18:12667464-12667486 AGAAAATATAATATTCGGCCAGG + Intronic
1154259588 18:12818796-12818818 AAAAATATAAATTTTCGGCCGGG + Intronic
1154969881 18:21397197-21397219 AAAAAAGAACATTTTCGGCCTGG + Intronic
1154996246 18:21642973-21642995 AAAATAAACAATTTTTAGCCGGG + Intergenic
1154998899 18:21667534-21667556 AAAAATTATAATTTTCGGCTGGG - Intronic
1155211390 18:23605214-23605236 ATAAAACAGAATTCTGGGCCGGG - Intronic
1155278327 18:24211666-24211688 AAAAAAAAAAAAATTCGGCCAGG + Intronic
1155290949 18:24340997-24341019 AAAATACAAACTTTTCGGCTGGG + Intronic
1155628626 18:27864821-27864843 AAAAAAGACACTTTGAGGCCAGG - Intergenic
1155950807 18:31911455-31911477 AAAAAAAAAAATTTCTGGCCGGG + Intronic
1155987572 18:32246175-32246197 AAAAAATAAAATATGCGGCCGGG - Intronic
1156069920 18:33194766-33194788 GAAAAACACAATTTCAGGCTTGG + Intronic
1156226286 18:35112464-35112486 AAAAGAAACAATGTTCTGCCGGG - Intronic
1156328257 18:36094113-36094135 AAAAAAAAAAATGTTGGGCCGGG - Intergenic
1156379851 18:36547895-36547917 ACACAAAACAATTTTGGGCCTGG + Intronic
1156660666 18:39342713-39342735 AAAAATCAAAAATTTCAGCCAGG + Intergenic
1156683470 18:39617998-39618020 ATAAAAATCCATTTTCGGCCAGG - Intergenic
1156689607 18:39691841-39691863 AAAATAAAGAAGTTTCGGCCGGG + Intergenic
1156700577 18:39819744-39819766 AAATAAAACAATTTTTGGCTTGG - Intergenic
1156897977 18:42268497-42268519 AAAAGACACAAATATTGGCCGGG + Intergenic
1156906680 18:42361425-42361447 AAAAAACTCACTTTTTGGCCGGG + Intergenic
1156966358 18:43098539-43098561 AGAAAACATAATTGTCAGCCTGG + Intronic
1157262323 18:46186801-46186823 TAAAAAAACAAAATTCGGCCGGG - Intronic
1157416741 18:47509723-47509745 ATAAAAGACAATTTTCGCCAGGG + Intergenic
1157697931 18:49738491-49738513 AAAAAACAAAATTAGCGGCCAGG - Intergenic
1157943087 18:51950721-51950743 AAAAATTATAATTTTTGGCCAGG + Intergenic
1158131661 18:54158921-54158943 AAAATACACATTTTTAGGCTGGG - Intronic
1158249415 18:55469991-55470013 AGAAAACACATTTTTTGCCCTGG + Intronic
1158364613 18:56719266-56719288 AAAAAACAGAATTGCTGGCCGGG + Intronic
1158465431 18:57685950-57685972 CAAAAACACAATTGTAGGCCGGG + Intronic
1158504587 18:58035252-58035274 AAAAAAACAAATTTTAGGCCAGG + Intergenic
1158607071 18:58905136-58905158 TAGAAACACAATTTTCAGGCCGG - Intronic
1158717403 18:59892920-59892942 TAAAAAAAAAATTTTCAGCCAGG - Intergenic
1158978061 18:62730524-62730546 AAAAAAATCTGTTTTCGGCCAGG + Intronic
1159220433 18:65456824-65456846 AAAGAAGACAATTCTCAGCCAGG - Intergenic
1159222430 18:65482105-65482127 TAAAAATACAGTTTTCGGCCAGG + Intergenic
1159329565 18:66973243-66973265 AAAAAACAGAACTATCAGCCTGG + Intergenic
1159814446 18:73055195-73055217 AAGAGACAGAGTTTTCGGCCGGG - Intergenic
1160101826 18:75927677-75927699 AAAAAACATAATTTTCAGGAAGG + Intergenic
1160183791 18:76659227-76659249 ATAAAACAAAATTTCTGGCCAGG + Intergenic
1160596347 18:79977253-79977275 TAAAATCACAAATTTAGGCCGGG - Intronic
1160645850 19:193111-193133 AAAAAACAAAACTTGAGGCCTGG + Intergenic
1160651214 19:229716-229738 AAAAAACAAAATTCCTGGCCAGG + Intergenic
1160658303 19:285622-285644 AAAAAAAACATTATTCAGCCTGG + Intronic
1160804333 19:985328-985350 AAAAAATACAAATGTGGGCCGGG - Intronic
1160953897 19:1680879-1680901 AAAAAACATGACTTTAGGCCCGG - Intergenic
1161099117 19:2411845-2411867 AAAAATTATAATTGTCGGCCGGG - Intronic
1161133099 19:2603358-2603380 AAAGAACACAGCTTTAGGCCGGG - Intronic
1161177177 19:2851289-2851311 AAAAAAAAAAATTCACGGCCAGG - Intronic
1161372237 19:3919296-3919318 AAAAATAAAAATTATCGGCCGGG + Intronic
1161379497 19:3957530-3957552 AAAATACAAAAATTACGGCCAGG + Intergenic
1161472425 19:4465418-4465440 AAAAAAAAAAATTCTTGGCCAGG + Intergenic
1161660204 19:5541144-5541166 AAAAAACACCATTATCAGGCTGG + Intergenic
1161727557 19:5938887-5938909 AGAAAAAACAATTATGGGCCAGG + Intronic
1161744323 19:6045980-6046002 AAAACACACAATTCAGGGCCAGG - Intronic
1161795906 19:6386736-6386758 AAAAAACACCTTTTTCGGCTGGG - Intronic
1161831479 19:6607932-6607954 AAAAATAAAAATTCTCGGCCAGG - Intergenic
1161923935 19:7287143-7287165 AAAAAAGAATATTTTTGGCCAGG - Intronic
1162047043 19:8006811-8006833 GAAAAACAAAATTGTAGGCCAGG - Intronic
1162140618 19:8583549-8583571 AAAAAAAAAAATTTACAGCCAGG + Intronic
1162207074 19:9064135-9064157 AAAAAAAAAAATTCTTGGCCAGG + Intergenic
1162211506 19:9095694-9095716 AAAAAAAAAAAATTTTGGCCAGG - Intergenic
1162406370 19:10476803-10476825 AAAAAAAAAAATTTTTGGCCGGG - Intergenic
1162500106 19:11048393-11048415 AAAAAACAAAAATTCCGGCCAGG - Intronic
1162579208 19:11518129-11518151 AAAAAAAAAAATTAGCGGCCGGG + Intronic
1162655966 19:12129913-12129935 AAAAAAAGGAATTTTTGGCCAGG + Intronic
1162702638 19:12529308-12529330 AAAGAAAACAAATTTTGGCCAGG + Intronic
1162712514 19:12606173-12606195 AAAAAATCCTATTTTAGGCCAGG - Intronic
1162851172 19:13432116-13432138 AAAAAAAAAAATTTTAGGCCAGG + Intronic
1162862028 19:13513361-13513383 AAAAATCACCATAGTCGGCCGGG + Intronic
1162900007 19:13789392-13789414 AAAAAAAAAAAATTTAGGCCAGG + Intergenic
1162914630 19:13867544-13867566 AACAAACAAAAATTTGGGCCAGG - Intronic
1163092585 19:15031174-15031196 AAGAAACACTACTTTAGGCCGGG - Intergenic
1163472103 19:17503634-17503656 AAAAAAAAAAATTGTTGGCCGGG + Intronic
1163480459 19:17552770-17552792 AAAATACAAAATTAGCGGCCGGG + Intronic
1163556476 19:17996307-17996329 AAAAAATAAAATTTTAAGCCTGG + Intronic
1163629571 19:18410977-18410999 AAAACATACAAATTTCGGCCGGG + Intergenic
1163645019 19:18484302-18484324 TAAAAACACAAACTTTGGCCAGG + Intronic
1163682808 19:18693093-18693115 AAGAAATTCATTTTTCGGCCGGG + Intronic
1163729865 19:18942583-18942605 AAAACACTCAAGTGTCGGCCAGG - Intergenic
1163989357 19:20984054-20984076 AAAAATCAGGATGTTCGGCCAGG + Intergenic
1164088405 19:21925493-21925515 TAAAACCACAATTGACGGCCGGG + Intergenic
1164102460 19:22069317-22069339 AAAATAAACAATATTAGGCCGGG + Intronic
1164134558 19:22401879-22401901 AGAAAATACAATTCTCGGTCAGG + Intronic
1164212211 19:23109046-23109068 AAAAGACACAATTTTTTGGCTGG - Intronic
1164255989 19:23528780-23528802 AAGAAACACAATCTTGGGCTGGG + Intronic
1164267163 19:23630591-23630613 AAAAAAAAAAAATTTAGGCCAGG + Intronic
1164269477 19:23658387-23658409 AACAAAGACAATTTTGGGCCAGG + Intronic
1164278832 19:23750544-23750566 AAAAAACACACTAGTAGGCCAGG + Intronic
1164313810 19:24069299-24069321 AAGAAACACAATCTTGGGCTGGG - Intronic
1164313861 19:24069620-24069642 AAAAAAAAGAATATTCTGCCAGG + Intronic
1164940075 19:32245370-32245392 AAAAAACACAATTATCTGGGAGG - Intergenic
1165171652 19:33896404-33896426 AAGAAAAACATTTTTTGGCCAGG + Intergenic
1165247734 19:34507061-34507083 AAAATACAAAATTTTTAGCCGGG + Exonic
1165452702 19:35893957-35893979 TAAAAAAACATTTTTCGGCTGGG + Intronic
1165456503 19:35914506-35914528 AAAAAAAAAAAATTTGGGCCAGG - Intergenic
1165497927 19:36164803-36164825 AAAAAAAAAAATTTTTGGCTGGG + Intergenic
1165586866 19:36924533-36924555 AAAAAATAACATTTTAGGCCAGG + Intronic
1165597801 19:37025331-37025353 AAAAAACAAGATTTTCAGACAGG - Intronic
1165618176 19:37220545-37220567 AAAAAAAACAAATATAGGCCAGG - Intronic
1165682283 19:37788374-37788396 AAAATACAAAATTTTTGGCCGGG + Intronic
1165764223 19:38340613-38340635 AAAAAATAAAATTATTGGCCGGG - Intronic
1165871158 19:38974375-38974397 AAAAAATATATTTTTAGGCCGGG - Intronic
1165878225 19:39024817-39024839 AAAAAAAAAAAGTTTGGGCCAGG - Exonic
1165942051 19:39419580-39419602 AAAAAATACAAAATTAGGCCGGG + Intronic
1166378310 19:42341134-42341156 TAAAAACAGAATTTTTGGCCAGG + Intronic
1166428030 19:42697227-42697249 AAAAAAAAAAAAATTCGGCCGGG - Intronic
1166770259 19:45277661-45277683 AAAAAAAAAAATTCTTGGCCAGG - Intronic
1166861152 19:45812074-45812096 AAAAAATACAAATGTTGGCCAGG - Intronic
1166880452 19:45926729-45926751 AAAAAATACATTTATTGGCCGGG - Intergenic
1166962167 19:46503967-46503989 AAAAACCATATTTTTCAGCCGGG + Intronic
1166994191 19:46711686-46711708 AAAAATTACTATTTTAGGCCGGG - Intronic
1167044546 19:47042010-47042032 AAAAAACACCCTTCTAGGCCAGG + Intronic
1167058306 19:47127299-47127321 AAAATACAAAATTTTAGGCATGG - Intronic
1167063657 19:47167805-47167827 AAAAAAAATTATTTTAGGCCAGG - Intronic
1167151219 19:47711231-47711253 TAAAAACACAAAATTAGGCCGGG + Intergenic
1167230043 19:48276817-48276839 AAAAATCACCATTTTGGGCTGGG - Intronic
1167495555 19:49816397-49816419 TTAAAACATAATCTTCGGCCGGG - Intronic
1167590170 19:50400200-50400222 AAAAAAAAAAATTATTGGCCAGG - Intronic
1167844770 19:52153031-52153053 AAAAAATCAAATGTTCGGCCAGG - Intergenic
1167864486 19:52313431-52313453 AAAAAAAAGAATTATAGGCCAGG - Intronic
1167883330 19:52480600-52480622 AAAAAAAAAAATTTTTGGCCGGG + Intronic
1167938551 19:52927055-52927077 AAAAAAGAAAAGTTTTGGCCAGG - Intergenic
1167956049 19:53064741-53064763 AAACAACACAAATTTAGGCTGGG - Intergenic
1168032014 19:53687858-53687880 AAAAAATACAAATGTAGGCCAGG - Intergenic
1168043157 19:53775095-53775117 AAAAAACAAATTTCTTGGCCAGG + Intergenic
1168109645 19:54184912-54184934 AAAAAAAAAAATTTAGGGCCAGG + Intronic
1168139791 19:54377966-54377988 AAAAAAAAAAACTTTAGGCCAGG + Intergenic
1168162022 19:54517058-54517080 ATAAGACACTATTTTCGGACAGG + Intergenic
1168350469 19:55672936-55672958 AAAAAAAAAAATTATTGGCCGGG - Intronic
1168460926 19:56557210-56557232 AAAAAAAAAAATTCTTGGCCGGG - Intergenic
1168603181 19:57736691-57736713 AAAAAACCAATTTCTCGGCCGGG - Intronic
1202699862 1_KI270712v1_random:156132-156154 AAAAAAAAAAAGTTTTGGCCAGG - Intergenic
925420737 2:3709120-3709142 AAAAACCACAGTTTTAAGCCAGG + Intronic
925822204 2:7810580-7810602 AAAAAAAACAATTATTGGCCAGG - Intergenic
926367800 2:12149219-12149241 ATAAAACACAGTTTATGGCCAGG - Intergenic
926556043 2:14359230-14359252 AAACAAAACAATTATCAGCCAGG + Intergenic
926714745 2:15915281-15915303 AAAACACACATTTTTAGGCTGGG + Intergenic
926912716 2:17866058-17866080 AAAAAATAGAGTTTTAGGCCGGG - Intergenic
926935886 2:18086302-18086324 TAAGACCCCAATTTTCGGCCAGG - Intronic
927015080 2:18951168-18951190 AAATAAAACAGTTTCCGGCCAGG + Intergenic
927147346 2:20175019-20175041 AAAAAAAAGAATTCTGGGCCAGG + Intergenic
927185689 2:20480512-20480534 AAAAAAAAAAATTTCAGGCCAGG + Intergenic
927398229 2:22680805-22680827 AAAAAGTACAATATTGGGCCCGG + Intergenic
927704409 2:25288137-25288159 AAGAAACACTTTTTTTGGCCAGG + Intronic
927775154 2:25897132-25897154 AAAAAACAAAAATTAAGGCCAGG - Intergenic
927775203 2:25897449-25897471 AAAATACAAAAATTACGGCCAGG - Intergenic
927818389 2:26241322-26241344 AAAATACACAATCTATGGCCGGG + Intronic
927867249 2:26598002-26598024 ATAAAAAACATTTTTTGGCCGGG + Intronic
927890710 2:26746617-26746639 AAAAAACACAAAATTTAGCCAGG - Intergenic
927899252 2:26807280-26807302 AAAAAAAAAAATTGTGGGCCAGG + Intergenic
927994623 2:27474845-27474867 AAAAAAAACAGTTTGAGGCCGGG - Intronic
928026367 2:27742695-27742717 AAAAAACACAAACAACGGCCAGG - Intergenic
928329213 2:30344834-30344856 AATAATAACAATTTTTGGCCGGG + Intergenic
928543974 2:32312191-32312213 ATAAAAATCTATTTTCGGCCAGG + Exonic
928683413 2:33725904-33725926 AAAAAAAAAAAGTTTCGGCCTGG - Intergenic
929191974 2:39148466-39148488 AAAAATCAAAATCCTCGGCCAGG + Intergenic
929499052 2:42474230-42474252 AAAAAAAACACTGTTCGGCCAGG + Intronic
929694022 2:44098940-44098962 AAAGAACACATATTTCGGCCAGG - Intergenic
929741175 2:44602164-44602186 AAAAAACACAAAAATCAGCCAGG - Intronic
930043933 2:47152056-47152078 TAAAAACTTAAATTTCGGCCGGG - Intronic
930064045 2:47313978-47314000 TAAAAACAAAATTTTCTGGCTGG + Intergenic
930179771 2:48342527-48342549 AAAATAAACAATTTTGGGCAAGG - Intronic
930186560 2:48417758-48417780 AAAAAAAAGAATTTTCCTCCCGG + Intergenic
930212226 2:48652932-48652954 AAATAACTCAAATTTAGGCCGGG + Intronic
930472922 2:51843209-51843231 AAAAAACACATTTACAGGCCCGG - Intergenic
930482439 2:51966073-51966095 AAAAAATACAAAGATCGGCCGGG + Intergenic
930637861 2:53825509-53825531 AAAAAAAAAAATTTGAGGCCGGG + Intergenic
930784051 2:55253381-55253403 AGTTAACACAATTTTCAGCCAGG + Intronic
931106767 2:59065525-59065547 TAAAAACACAAATTGCGGCAGGG + Intergenic
931280429 2:60786524-60786546 AAAAAAAAAAATTTCAGGCCAGG - Intronic
931302185 2:60991036-60991058 AAAAAATAAAATGTTAGGCCAGG - Intronic
931323449 2:61194961-61194983 AAAAAAAAAAGTTTTGGGCCAGG + Intronic
931654952 2:64502470-64502492 AAAAAACAAAATTGTGGGCCGGG + Intergenic
931724309 2:65094128-65094150 CAAAAACACAAAATTCAGCCAGG - Intronic
931806864 2:65815676-65815698 AAAAAATACAACTTTCTGGCTGG + Intergenic
931809381 2:65839926-65839948 AAAATTTACAATTTTAGGCCAGG + Intergenic
932139447 2:69262684-69262706 AAGAAACACAATGTAGGGCCTGG + Intergenic
932404041 2:71502044-71502066 AAAAATCACAAGTGTTGGCCAGG - Intronic
932741798 2:74296465-74296487 AAGAAAGCCAATTGTCGGCCAGG + Intronic
932779995 2:74553948-74553970 AAAAAAAAAAATGCTCGGCCAGG + Intronic
933108919 2:78372725-78372747 AAAAAGCAAAAGCTTCGGCCAGG + Intergenic
933238073 2:79887110-79887132 CAAAAACACAAGTCTGGGCCAGG - Intronic
933429423 2:82156485-82156507 AAAAATCACCATTCTTGGCCAGG - Intergenic
933681495 2:85105719-85105741 AAAAAAAAAAATTCTCGACCAGG + Intergenic
933700347 2:85250729-85250751 AAAAATCTCATTTTTCGGCTGGG - Intronic
933826113 2:86162548-86162570 AAAAAAAAAAAGTTTTGGCCGGG + Intronic
934170799 2:89539616-89539638 AAAAAAAAAAAGTTTTGGCCAGG - Intergenic
934184013 2:89655246-89655268 AAAAAACACAAGTTTTAGCTTGG + Intergenic
934281104 2:91613936-91613958 AAAAAAAAAAAGTTTTGGCCAGG - Intergenic
934294304 2:91729407-91729429 AAAAAACACAAGTTTTAGCTTGG + Intergenic
934508574 2:94917398-94917420 GAAAAAAACAATTCTCAGCCAGG + Intergenic
934718376 2:96556168-96556190 AAAAACCAGAATTTTTGGCCAGG + Intergenic
935297487 2:101663325-101663347 AATAAAGACAAGTTTTGGCCAGG - Intergenic
935303272 2:101712789-101712811 AACAAACAAATTTCTCGGCCTGG - Intronic
935374075 2:102377609-102377631 AAGAAACACATTTTCCAGCCTGG - Intronic
935396131 2:102611139-102611161 AAGAAAGAAAATTTTTGGCCGGG - Intergenic
935789374 2:106577068-106577090 AAAAAACACAACCTTAGGCCGGG - Intergenic
935883403 2:107590049-107590071 AAAAAGCAAAATTTTCAGCCGGG + Intergenic
935973177 2:108550823-108550845 AAAAAACCCAGCTTTAGGCCAGG + Intronic
935982646 2:108642652-108642674 AAAAAACACTAGTAGCGGCCGGG - Intronic
936120089 2:109733874-109733896 AAAAAAAAAAAATGTCGGCCGGG + Intergenic
936436730 2:112514086-112514108 AAGAAACTCATTTTTAGGCCAGG + Intronic
936442787 2:112569852-112569874 AAAAAACAAAATTTGAGGCCGGG - Intronic
936551236 2:113442032-113442054 AAAAAAAACATTTTTTGGCCAGG - Intronic
936764363 2:115827890-115827912 AAATAACTCACTTTTAGGCCGGG - Intronic
936938927 2:117863065-117863087 AAGAATCACTATTTTTGGCCAGG + Intergenic
937147729 2:119661741-119661763 AAAAAACACAAAAATTGGCCGGG + Intronic
937184569 2:120028157-120028179 AAAAAAAATAACTTCCGGCCGGG - Intronic
937184890 2:120030848-120030870 AATAAACATAATTTGAGGCCAGG - Intronic
937199919 2:120195143-120195165 AGAAAACGCTACTTTCGGCCGGG + Intergenic
937418201 2:121733985-121734007 AAAAAACCTAATGTTCGGGCTGG + Intronic
937591318 2:123615898-123615920 AAAGAACAAAAATTTCTGCCTGG + Intergenic
937712141 2:124990276-124990298 AAAAAAAAAAAATTTAGGCCAGG + Intergenic
938006709 2:127793133-127793155 CAAAAACTCAATTTAGGGCCTGG + Intronic
938052578 2:128188337-128188359 AAAGAATACTTTTTTCGGCCAGG - Intronic
938594353 2:132771984-132772006 AAAAAATACGAGTATCGGCCTGG - Intronic
938635939 2:133226234-133226256 AAAAACCACCTTTTTGGGCCCGG - Intronic
938840767 2:135160374-135160396 AAAAGACACATTTTGCGGCCGGG + Intronic
938849281 2:135243913-135243935 AAAAAAAAAAATTTAAGGCCGGG - Intronic
939335566 2:140823189-140823211 AGAAAACACTATATTCTGCCTGG - Intronic
939423527 2:142004548-142004570 TGAAAACACAATTGTCAGCCAGG + Intronic
939721475 2:145658315-145658337 AAAAAAAAAAATTCTTGGCCTGG - Intergenic
940142011 2:150501632-150501654 GAAAAATACAATTTCCGGCCAGG - Intronic
940207002 2:151214068-151214090 AAAAAAAAAAAGTTTAGGCCGGG + Intergenic
940232672 2:151473574-151473596 AAAGAACACAATTTTCTGGCTGG - Intronic
941102597 2:161312437-161312459 AAATAAATCAATTTTTGGCCAGG - Intronic
941332492 2:164195719-164195741 AAAAGATACAATTTTAGGGCTGG - Intergenic
941694795 2:168539258-168539280 TAAAAACAATATTTTCGGCCGGG - Intronic
941795705 2:169596398-169596420 TCAAAACACAATTTTCGGCCGGG - Intronic
941976941 2:171415643-171415665 AAAAAAGAATATTTTAGGCCAGG - Intronic
943063947 2:183067801-183067823 AAAAAACACAATTTTTGGCCAGG - Intergenic
943134947 2:183898211-183898233 AACAAAAACAATTTCAGGCCGGG + Intergenic
943223540 2:185140257-185140279 AAAAAATAATATTTTGGGCCAGG - Intergenic
943313508 2:186356828-186356850 AAAAAACAAATATTTAGGCCAGG + Intergenic
943370941 2:187014745-187014767 AAAAACCAAAATATTGGGCCGGG - Intergenic
943598955 2:189891516-189891538 AAAGAAAAGAATTTTCGGCCGGG - Intronic
944341537 2:198606297-198606319 AAAAAACAAGATTCTTGGCCAGG - Intergenic
944361582 2:198863175-198863197 CATAAAAACAATTTTCGGCCGGG - Intergenic
944551933 2:200852002-200852024 AAAAAACACAAAAATCAGCCAGG + Intergenic
944565896 2:200990863-200990885 AAAATACAAAATTTAAGGCCAGG - Intronic
944642084 2:201738003-201738025 AAAATACAGAATTTTTGGCCTGG + Intronic
944703886 2:202269330-202269352 AAAAAAAAAAAATTTAGGCCAGG - Intronic
944705977 2:202288821-202288843 AAAAAACAAAGTATTCGGCTGGG + Intronic
944749957 2:202698716-202698738 AAAAAAGTCAATTTTAGGCTGGG - Intronic
945233865 2:207616547-207616569 AAAAAACAGAATATCCGGCTGGG + Intronic
945257474 2:207814220-207814242 AAAAAAAATATTTTTAGGCCGGG - Intergenic
945400934 2:209382019-209382041 CAAAAATAAAATTTTTGGCCAGG + Intergenic
945737437 2:213617634-213617656 AAAAAAAATTATTTTGGGCCGGG - Intronic
945960559 2:216129969-216129991 AAGAAACACACTTTTAGGCCAGG - Intronic
945963713 2:216163293-216163315 AAAAAAAGTAATTTTTGGCCAGG - Intronic
946094859 2:217265153-217265175 AAAAAACACAAAATTTAGCCGGG - Intergenic
946242185 2:218363183-218363205 AAAATACATCATTTTGGGCCAGG + Intronic
946277297 2:218641232-218641254 AAAAAAAAAAATTATCGGCCAGG - Intronic
946279081 2:218653280-218653302 AAAAAAAAAAATTTCAGGCCGGG + Intronic
946451305 2:219782172-219782194 TAAAAACACAAATCTGGGCCGGG - Intergenic
946836665 2:223779670-223779692 AAAAGATTCAACTTTCGGCCAGG + Intronic
946920865 2:224581099-224581121 AAAAAACAGAACTATTGGCCGGG + Intronic
947168931 2:227291266-227291288 ATAAAAAACACTTGTCGGCCGGG + Intronic
947621769 2:231595340-231595362 AAAAAATAGATTTTACGGCCGGG + Intergenic
947778951 2:232739802-232739824 AAAAAACAAATATTTAGGCCGGG + Intronic
947839575 2:233198952-233198974 AAAAACAACAAATTTCGGCCGGG + Intronic
947987769 2:234463567-234463589 ATGAAATACAATTTTAGGCCAGG - Intergenic
948476473 2:238223940-238223962 GAAAAACACATTTTTCGACCAGG + Intergenic
948972220 2:241437966-241437988 AAAAAACACAAAAATCAGCCAGG - Intronic
1168746329 20:245381-245403 AAAAAACACATTCTTAGGCTGGG - Intergenic
1168833281 20:859159-859181 AAAAATCACAACCTTGGGCCTGG + Intergenic
1168929837 20:1612153-1612175 AAAAAACACAAAAATTGGCCAGG - Intronic
1169079522 20:2787713-2787735 AAAATTATCAATTTTCGGCCGGG - Intergenic
1169162659 20:3395264-3395286 AAAAAAGAAAATGTTCGGCCAGG - Intronic
1169320336 20:4627279-4627301 GAAAAAGAAAATTTTCAGCCGGG + Intergenic
1169329207 20:4703498-4703520 GACAAATACAATTCTCGGCCAGG + Intergenic
1169363466 20:4971497-4971519 ATAAAAAGCAATTTTGGGCCAGG + Intronic
1169452137 20:5721179-5721201 AAAAAAAACCTTTTTAGGCCAGG + Intergenic
1169462257 20:5805894-5805916 ATTAAACACAAATTTAGGCCAGG - Intronic
1170715994 20:18831495-18831517 AAAAAGTACAATATTCAGCCAGG - Intergenic
1170980227 20:21205665-21205687 AAAAAAAAAAAGTTTTGGCCAGG + Intronic
1171126371 20:22605434-22605456 AAGAAACAGGATTTTGGGCCTGG - Intergenic
1171297831 20:24034348-24034370 AAGAAAAACAAATTCCGGCCAGG - Intergenic
1171377925 20:24707409-24707431 AAAAAATACAAGTTATGGCCAGG - Intergenic
1171974341 20:31584711-31584733 AAAAAATACAAATATTGGCCAGG + Intergenic
1172049471 20:32105609-32105631 AAAAAATACAAATATTGGCCGGG + Intergenic
1172371947 20:34400230-34400252 ACAAAAAAAAATTTTTGGCCGGG - Intronic
1172455466 20:35068813-35068835 AATTAAAACAATTTTAGGCCGGG - Intronic
1172493712 20:35362652-35362674 ATAAAATACAAGTTTTGGCCGGG - Intronic
1172663265 20:36581938-36581960 AAAGAAAACATTTTTCGGCCGGG + Intronic
1172700313 20:36849593-36849615 AAAAAATACAACATTCAGCCAGG - Intronic
1172826101 20:37787637-37787659 AAAAAACACAGTTATGGGCCGGG - Intronic
1172937705 20:38632257-38632279 AAAAAAAAAAAATTTAGGCCGGG - Intronic
1173475468 20:43356118-43356140 TAAAAACGCAATTCTAGGCCGGG + Intergenic
1173525600 20:43730184-43730206 AAAAAATATTATTTTAGGCCAGG - Intergenic
1173540782 20:43849247-43849269 GAAAAACCCAAGTTTTGGCCAGG - Intergenic
1173665390 20:44759416-44759438 AAAAAACACAAAAATTGGCCGGG - Intronic
1173970623 20:47149546-47149568 AAAGAACACAAGTTTGGGCCAGG + Intronic
1174026497 20:47580803-47580825 AAAAAACATAACATTCGGTCCGG + Intronic
1174243145 20:49154568-49154590 AAGAAACACAATTCCTGGCCAGG + Intronic
1174350094 20:49960961-49960983 AAAGAACACATTTTTTGGCCAGG - Intergenic
1174350377 20:49963309-49963331 AAAAAAAAAAATTCACGGCCGGG - Intergenic
1174384806 20:50180933-50180955 AAAAAACAGAATTACTGGCCGGG + Intergenic
1174627192 20:51925675-51925697 AAAATACAAAATTTGCGGCTGGG + Intergenic
1174820157 20:53719617-53719639 AAGAAACACAATTTTGGAGCTGG + Intergenic
1174826943 20:53776995-53777017 ACAAAACAAAAATTTAGGCCAGG + Intergenic
1174869170 20:54167610-54167632 AAAAAACACAAAAATCAGCCAGG + Intronic
1175058077 20:56216388-56216410 AAGAAATAGAATTTTCAGCCAGG + Intergenic
1175067257 20:56299988-56300010 TAAAAACTCAAATTTCTGCCGGG + Intergenic
1175132721 20:56801624-56801646 AAAAAAAAAAATATCCGGCCGGG - Intergenic
1175666332 20:60863369-60863391 AAAAAATAAGATTTTTGGCCTGG - Intergenic
1175727359 20:61328468-61328490 AAAAACAGCAATTTTGGGCCGGG - Intronic
1176006780 20:62869277-62869299 AAAAAAAAGAATTTTGGGCTGGG - Intergenic
1176137980 20:63533359-63533381 ATAAAAGAAAATTTTAGGCCGGG - Intronic
1176279656 20:64293105-64293127 AAAAAACAAAACTTGAGGCCTGG - Intergenic
1176414201 21:6465836-6465858 AAAAAAAGCAGTTTTAGGCCGGG - Intergenic
1177020250 21:15846455-15846477 AATAAACACTATTTTTGGCATGG - Intronic
1177461305 21:21414762-21414784 AAGAAATACAATTTGTGGCCGGG - Intronic
1177617750 21:23546034-23546056 ACAAAACACAATTTATGGCCGGG + Intergenic
1177910100 21:27020165-27020187 AAAAAACATTATTTTTGGCCAGG + Intergenic
1178111301 21:29372747-29372769 AAAAAAAAAAATTTTAGGTCTGG - Intronic
1178292065 21:31377172-31377194 AAAAAAAAAAAGTTTCAGCCAGG - Intronic
1178294384 21:31396652-31396674 ATAAAACAAAATATTGGGCCAGG + Intronic
1178465842 21:32846823-32846845 CAAAAATACATTTTTCGGCCGGG - Intergenic
1178493523 21:33069269-33069291 AAAATACATAATTTCCTGCCAGG - Intergenic
1178611798 21:34089186-34089208 AAAAAACACAAAAATCAGCCAGG - Intronic
1178841919 21:36144635-36144657 AAATAAAAAAATTTTAGGCCAGG + Intronic
1178841938 21:36144806-36144828 AAATAAAAAAATTTTAGGCCAGG + Intronic
1178983977 21:37287573-37287595 AAAAAACACATGTTGGGGCCAGG - Intergenic
1179020405 21:37635511-37635533 AAAAAACAAAATAATAGGCCAGG - Intronic
1179083982 21:38201070-38201092 AAACAAAACAATTATCAGCCAGG - Intronic
1179115072 21:38483551-38483573 ATAAAAAGCAATTCTCGGCCAGG + Intronic
1179204749 21:39265126-39265148 AAAAAAAAAAAGTTTCAGCCAGG + Intronic
1179209266 21:39312681-39312703 ACAAAACAAAATCTTCAGCCGGG + Intronic
1179218114 21:39384553-39384575 AAAAAAAAAAATTGTCGGCCAGG - Intronic
1179611544 21:42555144-42555166 AAAAAATACAAAATTCAGCCAGG - Intronic
1179689699 21:43074158-43074180 AAAAAAAGCAGTTTTAGGCCGGG - Intronic
1179772803 21:43635942-43635964 AAAAAACAGAATCATAGGCCAGG + Intronic
1180689194 22:17697141-17697163 AAAAAAAAAAAATTTCGGCCGGG + Intronic
1180746295 22:18091335-18091357 AAAAAAAACAATTCTCGGCTGGG + Exonic
1180795044 22:18599239-18599261 AAAAAACATATTTTTTGGCCGGG - Intergenic
1180798194 22:18617979-18618001 TAAAAACTTAATTTTTGGCCGGG + Intergenic
1180873174 22:19159363-19159385 AAAAAACACAAAATTTAGCCCGG - Intergenic
1180909582 22:19439846-19439868 AAAAAACACACTATCAGGCCAGG - Intronic
1180963790 22:19775388-19775410 TAAAAACACAAATTTTGGCTGGG - Intronic
1181091396 22:20475166-20475188 AAAAAAGACAAATTTCTGCATGG - Intronic
1181101610 22:20544368-20544390 AAAGAACAGAAATTTAGGCCGGG + Intronic
1181223524 22:21377287-21377309 TAAAAACTTAATTTTTGGCCGGG - Intergenic
1181226694 22:21396077-21396099 AAAAAACATATTTTTTGGCCGGG + Intergenic
1181251955 22:21538775-21538797 AAAAAACATATTTTTTGGCCGGG - Intergenic
1181255218 22:21558335-21558357 TAAAAACTTAATTTTTGGCCGGG + Intronic
1181295972 22:21839388-21839410 AAAAAACTCAATAATAGGCCAGG + Intronic
1181654317 22:24283071-24283093 AAAAAACAAAGTTATCGGCCAGG - Intronic
1181676579 22:24457842-24457864 CAAAAACAAAATTAGCGGCCGGG - Intergenic
1181736942 22:24889639-24889661 AAAAAAATCAATTTAAGGCCAGG - Intronic
1181747678 22:24967178-24967200 AAAAATCACAATTTGCTGACAGG + Intronic
1181874128 22:25926588-25926610 ATACAACAAAACTTTCGGCCAGG - Intronic
1182222567 22:28770671-28770693 AAAAAAAGAACTTTTCGGCCAGG - Intergenic
1182328732 22:29534971-29534993 AAAAAAAAGCATTTTAGGCCGGG + Intronic
1182334474 22:29574481-29574503 CAAAAAGACAATTATCAGCCTGG + Intronic
1182381056 22:29888340-29888362 AAAAAACAACCTTTTAGGCCAGG - Intronic
1182503000 22:30762252-30762274 ATAAAATGCAATTTTGGGCCGGG + Intronic
1182505768 22:30781275-30781297 AAAAAACAAAAACATCGGCCGGG - Intronic
1182587209 22:31351211-31351233 AAAAAAAAAAATTATTGGCCGGG + Intergenic
1182590372 22:31374926-31374948 ATAAAAGACAATTTTAGGCTGGG + Intergenic
1182604844 22:31495357-31495379 ATAAAACATAATTTAGGGCCAGG + Intronic
1182612988 22:31564803-31564825 AAAAAAAAAAATTCTGGGCCAGG - Intronic
1182847984 22:33447188-33447210 TCAAAACACAATTCTGGGCCAGG - Intronic
1183217872 22:36492811-36492833 AAGAAATACACTTTTAGGCCAGG - Intronic
1183397366 22:37579727-37579749 AAAAAACAGCATCTTGGGCCAGG - Intronic
1183488634 22:38104789-38104811 AAAAAAAAAAATTTTTGGCTGGG - Intronic
1183571857 22:38659229-38659251 AAAAAAACCAATTGTAGGCCAGG - Intronic
1183755378 22:39757446-39757468 AAAATTAAAAATTTTCGGCCAGG + Intronic
1183809259 22:40240124-40240146 AAAATACCCAATATTCGGCCGGG - Intronic
1183894392 22:40956738-40956760 AAGAAACACACTCTTAGGCCAGG + Intronic
1183980743 22:41538553-41538575 AAAAAAGTCAAGTTGCGGCCGGG - Intronic
1183988338 22:41581692-41581714 AAAATACAAAATATTAGGCCGGG + Intronic
1184121827 22:42455814-42455836 AAAAAATACAATATTTAGCCGGG + Intergenic
1184170329 22:42755399-42755421 AAAAAAAAAAATTTGCTGCCGGG + Intergenic
1184203999 22:42989200-42989222 AGAAAACTCAATTCTCGGCCGGG + Intronic
1184344779 22:43906634-43906656 AAAAAAAAAAAAATTCGGCCGGG + Intergenic
1184464872 22:44662956-44662978 AAACAACACAAATTTTGGCCAGG + Intergenic
1184704176 22:46198952-46198974 AAAGAGAACAGTTTTCGGCCGGG - Intronic
949108267 3:226326-226348 AGAATACAGAATTTTCAGCCTGG - Intronic
949159084 3:859182-859204 GAAAAACACCATTTTCCCCCTGG + Intergenic
949184596 3:1175071-1175093 AAAAAACACAAAATTTGGCCAGG + Intronic
950071704 3:10157899-10157921 AAAAAATAAAAATTTCAGCCAGG - Intergenic
950234058 3:11303372-11303394 AAAAAAAAGAATTTTCCGCCAGG + Intronic
950372323 3:12541513-12541535 AAAAAAAACAATATTCAGGCTGG - Intronic
950491957 3:13311062-13311084 AAAAAAAAAAAGTTTTGGCCGGG - Intergenic
950599045 3:14015725-14015747 AAACAAAACAATTATCAGCCAGG - Intronic
950666464 3:14498300-14498322 AAAAAATACAATTATTAGCCAGG + Intronic
950815765 3:15700478-15700500 AAAAAACACTATATAGGGCCGGG + Intronic
951310165 3:21116319-21116341 ACACAACAAAATTTTCTGCCTGG - Intergenic
951487169 3:23226172-23226194 GGAAAATACACTTTTCGGCCAGG - Intronic
951632760 3:24739320-24739342 AAAAAACTCAAATACCGGCCAGG - Intergenic
951649631 3:24936688-24936710 AAAAATCATAATTTTCTGCCTGG - Intergenic
951650115 3:24941958-24941980 GAAAAATACATTTTTCAGCCTGG - Intergenic
952180718 3:30913790-30913812 AATAATCCCAATTTTTGGCCGGG - Intergenic
952368023 3:32692063-32692085 AAAAAAGCCAATTTCCCGCCAGG + Intronic
952410108 3:33041364-33041386 AAAAACTACAATTTGAGGCCGGG + Intronic
952414655 3:33080078-33080100 AAAAAAAACAGTTTTCAGGCTGG - Intronic
952475079 3:33700548-33700570 AAAAAAATCAATTGTGGGCCAGG + Intronic
952674143 3:36006819-36006841 AAAAAACACAAATATTGGCAAGG + Intergenic
952775650 3:37043535-37043557 AAAAAAAAAAATTTGAGGCCAGG - Intronic
952802520 3:37309258-37309280 AAAAATAACAATTATAGGCCGGG + Intronic
953008592 3:39001737-39001759 ACAAAACACTATTATTGGCCGGG + Intergenic
953046899 3:39301644-39301666 AAAAAACAAAATTTTGGGCTGGG + Intergenic
953340672 3:42131760-42131782 AAAAAATACAATCCTTGGCCAGG + Intronic
953380222 3:42465149-42465171 AAAAAAAAAAGTTTTTGGCCGGG + Intergenic
953400876 3:42615372-42615394 AAAAAAAAAAAATCTCGGCCAGG - Intronic
953601775 3:44372887-44372909 TAAAAAGAAAATTTTGGGCCGGG - Intronic
953663963 3:44912124-44912146 AAAATACAAACTGTTCGGCCGGG - Intronic
953701960 3:45203429-45203451 AAAAAACACAAAATTTAGCCAGG + Intergenic
953922511 3:46962136-46962158 AAAGAATTCAATTTTGGGCCAGG + Intronic
953993161 3:47499356-47499378 AAAAAACACAAAATTTAGCCGGG + Intronic
954015280 3:47683955-47683977 AAAAAAGACAGTACTCGGCCGGG + Intronic
954026767 3:47789302-47789324 AAAAATTACATTTTCCGGCCGGG + Intergenic
954166170 3:48760060-48760082 AAAAAACAAAAATGTAGGCCAGG + Intronic
954179356 3:48869515-48869537 AAAAAAAAGGTTTTTCGGCCGGG - Intronic
954183808 3:48901577-48901599 AAAAAAAAGAATTATGGGCCGGG + Intergenic
954187718 3:48931719-48931741 AAAAATCACAATTTTCAGCCGGG + Intronic
954229479 3:49205586-49205608 AAAAAAAAAAAATTACGGCCAGG - Intronic
954302828 3:49709593-49709615 AAAAAATACAAAATTAGGCCAGG - Intronic
954348740 3:50024656-50024678 GAAAAAAACAGTTTTTGGCCGGG + Intronic
954454377 3:50589599-50589621 TAAAAAAATAATTTTAGGCCGGG + Intergenic
954811177 3:53249263-53249285 TAAAAACAAATTTTTAGGCCAGG - Intronic
954968410 3:54630904-54630926 AAAAAACACAATGATAGGCCAGG + Intronic
955128419 3:56138354-56138376 AAAAAATACCATTTTCAGGCTGG - Intronic
955174906 3:56604562-56604584 AAAAAAAAGAATTTTCAACCCGG - Intronic
955234451 3:57127118-57127140 AAAAAACCCATCTTCCGGCCGGG - Intronic
955241856 3:57185548-57185570 TAAAAACCCAATCTCCGGCCGGG + Intergenic
955262225 3:57404418-57404440 AAGAAACAAAAGTTTCGGCCAGG + Intronic
955301785 3:57787029-57787051 AAACTACATAATTTTCGGCAGGG - Intronic
955331839 3:58053755-58053777 AAAAACCACATGTTTGGGCCAGG - Intronic
955540372 3:59969971-59969993 AGAAAACACAATTTTCTGGAGGG - Intronic
955931919 3:64066045-64066067 AAAAATAACAAGTTTCAGCCTGG - Intergenic
956316891 3:67948076-67948098 GAAAAACACAATATTTGGTCAGG - Intergenic
956415660 3:69026299-69026321 CAAAAATACAATATTTGGCCAGG + Intronic
956766722 3:72490584-72490606 AAAAAACACAAAACTTGGCCGGG + Intergenic
956797516 3:72730111-72730133 AAAAAATAAAATTTAGGGCCGGG - Intergenic
956961446 3:74407248-74407270 AAAAAATAGAATATTTGGCCTGG - Intronic
957200390 3:77127082-77127104 GAAAAAAAGAAGTTTCGGCCTGG - Intronic
957387014 3:79509105-79509127 ATAAAACACTATTTTTGGGCAGG + Intronic
957488859 3:80897372-80897394 AAAAAGCACAATATTCGGGTGGG + Intergenic
957509574 3:81169874-81169896 AAAATACATAGGTTTCGGCCGGG - Intergenic
957701636 3:83723070-83723092 AAAAAAAACATGTTTTGGCCGGG - Intergenic
957856475 3:85885375-85885397 AAAAAATACAAAATTAGGCCAGG + Intronic
957858384 3:85909017-85909039 AAAAATCACAACTGTAGGCCGGG - Intronic
957883755 3:86255931-86255953 AAAAGATTCTATTTTCGGCCGGG - Intergenic
958029265 3:88087368-88087390 AAAAACCAGGATTTTCAGCCAGG - Intronic
958042087 3:88238960-88238982 TAAAAAGCCAATTTTAGGCCAGG + Intergenic
958428278 3:94006003-94006025 AATAAATACAATTTTGAGCCGGG + Intronic
958632181 3:96699163-96699185 AAAGAACAAAAGTTTCTGCCTGG - Intergenic
958649303 3:96917123-96917145 CAAACACACATTTTTTGGCCGGG + Intronic
958929501 3:100193804-100193826 AAAAAAATCAATTTTGGGGCTGG - Intronic
959088946 3:101881681-101881703 AAAAAACAAAACATTCGGCTGGG - Intergenic
959436346 3:106319027-106319049 AAACAAAACAATTATCAGCCAGG + Intergenic
959474129 3:106788690-106788712 AAAAAAGAAAAGTTTGGGCCAGG - Intergenic
959891945 3:111566847-111566869 AAAGAACAGAATTTTAGGGCAGG + Intronic
959927869 3:111944965-111944987 TAAAAACATTATTTTCAGCCAGG - Intronic
960094950 3:113680514-113680536 AAAAAACAAACTTTTTGGCCAGG + Intronic
960235317 3:115274958-115274980 AGAAAAGTCAATTTTCAGCCAGG - Intergenic
960590946 3:119364795-119364817 AAAAAAAACAATTCTTGGCCAGG + Intronic
960668196 3:120131451-120131473 AAAAAACACCATGGTCGGCCAGG + Intergenic
960751063 3:120953631-120953653 AAAAAACTCAATTGTGGGCTAGG - Intronic
960806374 3:121587345-121587367 AAAAAACACAAAAATTGGCCAGG - Intergenic
960940989 3:122934201-122934223 TAAAAACAAAATTTTTGGGCCGG - Intronic
960976261 3:123177696-123177718 AAAAAATACAAATATCAGCCAGG - Intronic
961566417 3:127766773-127766795 AAAAAACACTAGTTACGGCCGGG + Intronic
961576323 3:127839728-127839750 AAATAACACAATTATTGGCTGGG + Intergenic
961941759 3:130645571-130645593 AAGAAATACTATTTTTGGCCAGG - Intronic
961963616 3:130879360-130879382 AAAAAACAGAAATATCAGCCAGG - Intronic
961975653 3:131022476-131022498 AAAAAAAAAAATTTTTTGCCAGG - Intronic
962165211 3:133040496-133040518 AAAAAAAAAAATTTTCTGGCCGG - Intronic
962329058 3:134461617-134461639 TAAAAAGTCAATTTTTGGCCAGG + Intergenic
962518552 3:136176529-136176551 AAAAAAAAAACTTTTCGGCTGGG + Intronic
962715445 3:138122102-138122124 CAAAAACATAATTTACTGCCAGG + Intergenic
962796643 3:138855349-138855371 ATAAAACAGAAATGTCGGCCAGG - Intergenic
963090984 3:141483839-141483861 AGAAAACTTTATTTTCGGCCGGG + Intergenic
963109947 3:141680188-141680210 AAGAAATACATTTTTTGGCCAGG + Intergenic
963147571 3:142010313-142010335 AAAAAACTAACTTTTGGGCCGGG + Intronic
963513726 3:146281212-146281234 AAAAAAATCAATTCTTGGCCTGG - Intergenic
963549147 3:146698731-146698753 AAAAAAAAAAATTTTTAGCCAGG - Intergenic
963780162 3:149479060-149479082 AAAAAACAGAACAATCGGCCAGG - Intronic
964049963 3:152378875-152378897 AAAAAATGCAATTATCAGCCAGG - Intronic
964110310 3:153080419-153080441 TAAAAACATAATTTTGGGCCGGG - Intergenic
964116615 3:153142493-153142515 AAAAAACATAATTACAGGCCAGG + Intergenic
964365505 3:155946710-155946732 AAAAAACACAAATATTAGCCAGG + Intergenic
964604579 3:158546394-158546416 AAAAAATTTGATTTTCGGCCAGG - Intergenic
965096031 3:164227067-164227089 AAAAAAAACACTTTTTGGTCAGG + Intergenic
965188725 3:165501124-165501146 AAAAAAAAAAATTTGGGGCCGGG - Intergenic
965367492 3:167818321-167818343 AAAATACAAAATATTTGGCCGGG - Intronic
965797143 3:172450704-172450726 TAAAAACTCAATTTGGGGCCGGG - Intergenic
965829488 3:172768025-172768047 AAAGAAAAAAATTTGCGGCCAGG - Intronic
965840545 3:172900933-172900955 AAATTACCCAATTTTAGGCCAGG - Intronic
965877773 3:173348659-173348681 ATAAAATACAATTTAAGGCCAGG - Intergenic
965944806 3:174227016-174227038 ATTAAACATAATTTTAGGCCTGG + Intronic
965970948 3:174555593-174555615 AAAAAACTGAATTTTTGGCCAGG - Intronic
966186921 3:177235742-177235764 AAAAATCACTCTTTTAGGCCAGG + Intergenic
966271664 3:178114928-178114950 AAAATACAAAATTAGCGGCCGGG + Intergenic
966379666 3:179331481-179331503 TAAAAGCACAACTTTAGGCCAGG + Intronic
966402490 3:179562284-179562306 AAAAAAAAAAATTTCAGGCCGGG - Intergenic
966683135 3:182664690-182664712 AAAAAACACAAAAATCAGCCAGG - Intergenic
966882111 3:184356346-184356368 AAAAAAAAAAAATCTCGGCCGGG + Intronic
966990378 3:185224202-185224224 GAAAAAAAAAAATTTCGGCCGGG + Intronic
967056697 3:185835520-185835542 AAAAATCACAAGTTTGGGCTGGG + Intergenic
967164930 3:186772287-186772309 AAAAAACAACAGTTTTGGCCAGG - Intergenic
967311377 3:188109651-188109673 GAAAAATAAAATTTTGGGCCGGG + Intergenic
967333715 3:188319051-188319073 AAGAATCATAATTTTTGGCCGGG - Intronic
967402052 3:189074497-189074519 AAAGAAAACAATTCTGGGCCGGG - Intronic
968146604 3:196304426-196304448 AAAAAAAACAGTTTTTGGCCAGG - Intronic
968173111 3:196526274-196526296 AAAAATCAAAATATGCGGCCAGG + Intergenic
968185306 3:196629228-196629250 TTAAAATACAATTATCGGCCAGG - Intergenic
968189306 3:196655876-196655898 AAGAAACACATATTTAGGCCAGG + Intronic
968220668 3:196936764-196936786 AAAGAACACAATTTCTGACCTGG + Exonic
968243360 3:197114685-197114707 AAAAAGGGAAATTTTCGGCCAGG + Intronic
968312668 3:197696915-197696937 AAAATATACAATTTTAGCCCTGG + Intronic
968366618 3:198190264-198190286 AAAAAACAAAATTCCTGGCCAGG - Intergenic
968371831 3:198226415-198226437 AAAAAACAAAACTTGAGGCCTGG - Intergenic
968822334 4:2864115-2864137 AAATAACAGAATTTATGGCCGGG + Intronic
968828895 4:2921421-2921443 AAAGAAAAGAATTTTCGGCCGGG - Intronic
968865923 4:3211197-3211219 AAGATAAACAATTTTAGGCCGGG - Intronic
969464610 4:7348846-7348868 TAAAAACACAAGATTCGGCCTGG - Intronic
969626591 4:8308793-8308815 AGAAAACAACATTATCGGCCAGG - Intergenic
970156386 4:13145574-13145596 TAAAAACAACATTTTGGGCCAGG - Intergenic
970541252 4:17082084-17082106 AAAAAACACTTATGTCGGCCAGG - Intergenic
970844017 4:20514343-20514365 AAAAAATAAAAATTTCAGCCAGG + Intronic
970975571 4:22039460-22039482 AAAGAAAAGAATTTTCGGCCAGG - Intergenic
971034443 4:22677743-22677765 AAAAAATAAAAATTTCAGCCAGG - Intergenic
971271759 4:25156407-25156429 AAAAAAAAGTCTTTTCGGCCGGG + Intronic
971791936 4:31181253-31181275 AAAAATCAAAGATTTCGGCCAGG + Intergenic
971880681 4:32366280-32366302 AAAAAGCACAATATTCGGGTGGG + Intergenic
971937474 4:33171065-33171087 AAAGAATACAATTTGAGGCCGGG + Intergenic
971956787 4:33430674-33430696 AAAATTCACCATTTTAGGCCTGG - Intergenic
972224115 4:36991999-36992021 AAAAAACGTTATTTTCGGCCAGG - Intergenic
972499288 4:39662496-39662518 AAAAAAAAAAATTATAGGCCGGG - Intergenic
972518226 4:39829654-39829676 AAAAAAAAAAATTTCCGGCCAGG + Intronic
972525883 4:39910971-39910993 AAAAAACACAAAAATCAGCCGGG + Intronic
972545550 4:40076781-40076803 AAAAAAGATATTTTTGGGCCGGG - Intronic
972727021 4:41753652-41753674 AAAAAATAAAATTTTCCACCTGG - Intergenic
972751790 4:41996386-41996408 AAAATACTCAAATTTCGGCCAGG - Intronic
973338434 4:48979803-48979825 AAAAAATACAAGAATCGGCCAGG - Intergenic
973629659 4:52808173-52808195 AAAAAAAAGAAAGTTCGGCCGGG + Intergenic
973769062 4:54190127-54190149 CAAAAAAACAATTTAAGGCCAGG + Intronic
973889031 4:55351061-55351083 AAAAAAAAAAAATTTAGGCCAGG - Intronic
973891911 4:55375901-55375923 AAAAAAAACATATTTGGGCCAGG - Intergenic
973992325 4:56421973-56421995 TTAAAACACAATTCTGGGCCAGG + Intronic
974004102 4:56538511-56538533 AGAAAACATTATTTTAGGCCGGG + Intronic
974047937 4:56912939-56912961 AAAAAAAAAAAGTTTCGGCTGGG - Intronic
974050804 4:56939862-56939884 AAAAAATATATTTTTCGGCCAGG - Intergenic
974113724 4:57555543-57555565 AAAAAACGAAATTTCCGGCTGGG - Intergenic
974160673 4:58133964-58133986 AAAATACAGCATTTTAGGCCAGG + Intergenic
974256652 4:59465250-59465272 AATTAAAATAATTTTCGGCCGGG + Intergenic
974556360 4:63453717-63453739 AAGAAACATAACTTTTGGCCGGG - Intergenic
974586400 4:63884615-63884637 AAGAAAAACAATTTTCAACCAGG + Intergenic
974677906 4:65119092-65119114 AAAAAAAACAAGTGTCGGCAAGG - Intergenic
975164518 4:71163076-71163098 CAAGAAAACAATTTTAGGCCAGG + Intergenic
975250398 4:72172042-72172064 AAAAAAAACAGTTTTCCTCCTGG - Intergenic
975372258 4:73602791-73602813 AATAGACACAAGTTTCGGCCAGG + Intronic
975381805 4:73709118-73709140 AAGAACGACAATTTTTGGCCAGG + Intergenic
975496277 4:75039234-75039256 TAAAAACACAGTTTCCGGCCGGG + Intronic
976028572 4:80722603-80722625 AGAAAACAAAAAATTCGGCCGGG + Intronic
976128202 4:81855758-81855780 AAAAAACACGAGTTTCAGCCAGG - Intronic
976178415 4:82376841-82376863 AAAAAAAAAAACTTTTGGCCAGG + Intergenic
976237598 4:82915550-82915572 AAAAAACACACTTATGGGCCAGG - Intronic
976553171 4:86420490-86420512 TAAAAACTCAATTTTTGGCTGGG + Intronic
976556596 4:86458000-86458022 AAAAAATACAAAATTAGGCCAGG + Intronic
976807674 4:89066285-89066307 TAAAAAAAAAATTCTCGGCCAGG + Intronic
977598954 4:98915250-98915272 TAAATACTTAATTTTCGGCCGGG - Intronic
978448727 4:108805830-108805852 AAAAAAAAAAATTTCAGGCCAGG + Intergenic
978726293 4:111973418-111973440 AGAAAAAACAATTCTAGGCCAGG - Intergenic
978786606 4:112616539-112616561 AAGAAACACAATTATGGGCCAGG + Intronic
979260521 4:118638891-118638913 AAAAAACAAAACTTGAGGCCTGG - Intergenic
979333313 4:119440640-119440662 AAAAAACAAAATTCCTGGCCTGG + Intergenic
979338438 4:119490990-119491012 AAAAAACTCAATTTTATGTCAGG + Intergenic
979480665 4:121213429-121213451 AAAAAAGACATTCTTCAGCCAGG + Intronic
979538374 4:121850459-121850481 TAAAAACACAGTTTCTGGCCTGG - Intronic
979892081 4:126110563-126110585 AAAAAAGATAATTTTAAGCCGGG - Intergenic
980055904 4:128079388-128079410 AAAAGACAAACTATTCGGCCAGG - Intronic
980074832 4:128284104-128284126 AAAAAACATGCCTTTCGGCCAGG - Intronic
980117790 4:128696337-128696359 AATAAAAACTATTTTAGGCCAGG - Intergenic
980502182 4:133670359-133670381 AAAAATCATAATTCTAGGCCAGG - Intergenic
980905102 4:138940657-138940679 AAGAAAAAGAATTTTGGGCCGGG + Intergenic
981132622 4:141174816-141174838 TAAAAACAGACTTTTCTGCCTGG + Intronic
981191117 4:141864824-141864846 AAAAAATACAAATTTTAGCCGGG - Intergenic
981546638 4:145900703-145900725 ATAAAATAAAATTTTAGGCCGGG - Intronic
981706875 4:147669091-147669113 AAAAAAAAGTATTTTTGGCCAGG + Intronic
981946000 4:150344844-150344866 ATAAAACATAATTTTCAGCAGGG - Intronic
981946425 4:150350274-150350296 AAAAAACAAAACTTGTGGCCGGG + Intronic
981977346 4:150746803-150746825 AAGAAAAACAACTTTTGGCCGGG - Intronic
982211726 4:153042408-153042430 AATAAAAGCAATTTTAGGCCAGG - Intergenic
982252895 4:153425142-153425164 AAAAAACATATTTATTGGCCAGG + Intergenic
982631288 4:157832521-157832543 AAAAAAATCTATTTTCGGCCAGG - Intergenic
982896365 4:160932646-160932668 AAAAAAAAAAATCTTCGGCCAGG - Intergenic
982920509 4:161267824-161267846 AGAAAATCCCATTTTCGGCCGGG - Intergenic
982988650 4:162242918-162242940 AAAAAAAAAAAGTTCCGGCCGGG + Intergenic
983026780 4:162747389-162747411 TAAAAACTCAATAGTCGGCCGGG - Intergenic
983430959 4:167650736-167650758 AAAAAATCCAATTATAGGCCGGG + Intergenic
983593079 4:169436197-169436219 TAAAATAACAATTTTAGGCCAGG - Intronic
983703065 4:170622571-170622593 ATAAAACTTAATTTCCGGCCGGG - Intergenic
983890089 4:173021696-173021718 AAAACACACCGTTTTAGGCCTGG + Intronic
984299341 4:177894877-177894899 AAAAAACACAGTATCTGGCCAGG - Intronic
984329970 4:178302287-178302309 AAAAAATGAAATTTTAGGCCGGG + Intergenic
984433292 4:179676152-179676174 AAAAAACATAAATTTAGGCTGGG - Intergenic
984482249 4:180320116-180320138 AAAAATCAAATTTTTCGGCCAGG - Intergenic
984524546 4:180842592-180842614 TAAAAACACAATTTCAGGCCTGG + Intergenic
984826194 4:183926915-183926937 AAAAAACACTATTTGTGGTCGGG - Intronic
984919292 4:184749810-184749832 AAAAAACAGAAGTACCGGCCAGG + Intergenic
985042708 4:185907493-185907515 AAGAAACACATTTTGTGGCCTGG + Intronic
985221422 4:187709814-187709836 AAAAAAAAAAATTTGAGGCCAGG + Intergenic
985254707 4:188058199-188058221 AAAAATCACAAAATTCGGCCGGG - Intergenic
986001795 5:3636147-3636169 AAGAACCACAATTTTCGGCCAGG - Intergenic
986361826 5:6985996-6986018 AAAAAAAATAACTTTGGGCCGGG + Intergenic
986466245 5:8027496-8027518 AATAAAAATAATTATCGGCCGGG - Intergenic
986681846 5:10240698-10240720 AAATAACACCATTTATGGCCAGG + Intronic
986695280 5:10349687-10349709 AAAAAAAAAAATTTTTGGCCTGG + Intergenic
986696953 5:10365585-10365607 AAAAATTCCAATTCTCGGCCAGG - Intronic
986715011 5:10517034-10517056 GTAAAACCCAATTTTTGGCCAGG - Intronic
987272821 5:16329666-16329688 GAAAAATAGAATTTTGGGCCAGG - Intergenic
987272915 5:16330817-16330839 GAAAAATAAAATTTTGGGCCAGG - Intergenic
987322911 5:16786871-16786893 AAAAAAAAAAATTTTTGGCCGGG + Intronic
987558178 5:19482409-19482431 AAAAACAATAATTTTTGGCCAGG - Intronic
987602604 5:20091188-20091210 ACAAAACACATTTTAAGGCCAGG + Intronic
987722248 5:21651775-21651797 AAAAAAAATTATTTTCGGCCGGG - Intergenic
987943266 5:24570059-24570081 AAAACACACACTTGTTGGCCGGG - Intronic
988139760 5:27220652-27220674 AAATAAAAAAATTTACGGCCAGG - Intergenic
988296891 5:29375928-29375950 AAAATGAACAAATTTCGGCCGGG - Intergenic
988338176 5:29933774-29933796 GAAAAACACACTTATGGGCCAGG - Intergenic
988476453 5:31590284-31590306 AAAAAAAAAAATTATTGGCCGGG + Intergenic
988570276 5:32358363-32358385 AAAAAAGAAAATTTAAGGCCGGG + Intronic
988622866 5:32841507-32841529 AAAAAATTCCATTTTAGGCCAGG - Intergenic
989041161 5:37231282-37231304 AAAAACGAAAATATTCGGCCAGG + Intronic
989067303 5:37476947-37476969 AAAAAATACAGTATTCTGCCAGG - Intronic
989392943 5:40921875-40921897 AAAAAATACAATAATCAGCCAGG + Intronic
989478071 5:41897005-41897027 AAAAAACACAACTTATGCCCAGG - Intergenic
989594376 5:43142597-43142619 AAAATATCCAATTTTTGGCCGGG - Intronic
989759425 5:44994940-44994962 AAAAAAGAAAAAGTTCGGCCGGG - Intergenic
990039056 5:51357358-51357380 AAAAAGAAAAATTTTCAGCCTGG + Intergenic
990078279 5:51879089-51879111 AAAAAAATAAATTTTTGGCCAGG + Intergenic
990223432 5:53621993-53622015 AAAAATAATAATTTACGGCCGGG - Intronic
990672929 5:58152741-58152763 TAAAAACAAAAATTACGGCCGGG + Intergenic
990758853 5:59106465-59106487 AAAAACCACCATGTTAGGCCGGG + Intronic
991022762 5:61997798-61997820 TTTAAAAACAATTTTCGGCCGGG + Intergenic
991063081 5:62399169-62399191 AAAATACAAAATATTAGGCCAGG + Intronic
991314695 5:65287823-65287845 AAAAATCATAATTATTGGCCAGG - Intronic
991327289 5:65449318-65449340 TAAAAAGAAAATTTTGGGCCAGG + Intronic
991356411 5:65773645-65773667 AAGAAACTCAATATTTGGCCAGG + Intronic
991682315 5:69151428-69151450 AAAAAACACACATATTGGCCAGG + Intergenic
991689882 5:69215704-69215726 AAAAAAAAAAATTATCGGCTGGG + Intergenic
991697158 5:69283781-69283803 AAAAAAAAAAATTGTCAGCCTGG - Intronic
991708704 5:69385253-69385275 AAAAAAAAAGATTTTAGGCCAGG - Intronic
991731555 5:69594319-69594341 TAAAATCACAAATTTCGGCCGGG - Intronic
991807987 5:70449465-70449487 TAAAATCACAAATTTCGGCCGGG - Intergenic
991863396 5:71033546-71033568 TAAAATCACAAATTTCGGCCGGG + Intergenic
992257668 5:74937501-74937523 AAAAAACAGACTTTAGGGCCAGG - Intergenic
992258746 5:74948891-74948913 AAAAATTACAGTTTTAGGCCGGG + Intergenic
992312629 5:75516681-75516703 AAATAAAACAACTTTTGGCCAGG + Intronic
992436194 5:76758166-76758188 AAATATCAGAATTTTCAGCCGGG - Intergenic
992555485 5:77898892-77898914 AAAAAATACAATAATCAGCCAGG + Intergenic
992652514 5:78873788-78873810 AAAAATTACAGTTTTAGGCCGGG - Intronic
992731249 5:79671805-79671827 AAAAATTACTATTTTCGGCCGGG + Intronic
992741451 5:79777474-79777496 TAAAAAAAAAATTTTAGGCCAGG + Intronic
992820333 5:80489627-80489649 AAAAAACAAATTTTTGGGCCGGG + Intronic
992854611 5:80847347-80847369 AAAAAAAAAAATATTCAGCCAGG - Intronic
992967037 5:82013120-82013142 AAAAAACACAAAAATTGGCCGGG - Intronic
992983393 5:82201178-82201200 AAAAAATATATTTTTAGGCCGGG - Intronic
993041162 5:82816430-82816452 ACAAAACACTTTTTTCGGCAGGG + Intergenic
993213247 5:84982959-84982981 AAAAAAAACAAATTTAGGCTAGG + Intergenic
993463744 5:88218762-88218784 CAAAAACATAATTTTCGGCCTGG + Intronic
993640836 5:90403574-90403596 AAAAATCACAATTTTTGGCCGGG + Intronic
993695520 5:91057149-91057171 AAACAACACAATTTTCGTAAAGG - Intronic
993940475 5:94051978-94052000 AAAAAATACAAAATTCAGCCAGG - Intronic
994086789 5:95767624-95767646 GAAAAATACATTTTTTGGCCAGG - Intronic
994193935 5:96900958-96900980 AGAAAACACAATTTAGGGCCAGG - Intronic
994371179 5:98969408-98969430 AAAAAAAAAAAGTTTAGGCCGGG - Intergenic
994581768 5:101651458-101651480 AAAGAATAAAGTTTTCGGCCGGG - Intergenic
994695408 5:103067508-103067530 AAAAATCACAAATTTTGGCCAGG - Intergenic
994863606 5:105232955-105232977 AAAAAAAAAAATTTTCTGGCCGG - Intergenic
994931008 5:106185653-106185675 AAAAAACACAAAATTTAGCCAGG + Intergenic
995654178 5:114406003-114406025 TAAAAAAAAAATATTCGGCCTGG - Intronic
995858016 5:116614274-116614296 AAGAAATACAATATACGGCCAGG + Intergenic
996055952 5:118982982-118983004 AAAATAAACTATTTTGGGCCAGG - Intronic
996325578 5:122268871-122268893 AAACAAAACAATTATCAGCCAGG + Intergenic
996437310 5:123448981-123449003 AAAAAATATAATCTCCGGCCAGG - Intergenic
996641134 5:125755021-125755043 TGAAAACACAAGTTTGGGCCAGG - Intergenic
996706448 5:126503011-126503033 AAAAAACACAAATATTAGCCGGG + Intergenic
996739460 5:126785616-126785638 AAAAAATTTAATTTTTGGCCTGG - Intronic
996759629 5:126974190-126974212 AAAAAATAGATTTTGCGGCCGGG - Intronic
996946812 5:129080309-129080331 GAAAAACACAAGTTTGGGCCAGG + Intergenic
997156511 5:131565984-131566006 AAAAAACACAAAAATCAGCCAGG + Intronic
997310936 5:132881960-132881982 TAAAAACATAATTTGTGGCCGGG - Intronic
997313805 5:132915041-132915063 AAAAAATACCATTTCTGGCCAGG + Intronic
997679710 5:135741440-135741462 AAAAATTGCAATTTTAGGCCAGG + Intergenic
997761099 5:136447929-136447951 AAACAAAACAATTATCAGCCAGG + Intergenic
997928508 5:138052938-138052960 AAAAAACAGAATTTCTGGCCAGG + Intergenic
997931093 5:138071917-138071939 AAAATACATATTTTTTGGCCGGG + Intergenic
998034671 5:138904797-138904819 AAAAAATACATATTTTGGCCGGG + Intronic
998055864 5:139076833-139076855 GAAAAAAGCAATTCTCGGCCGGG + Intronic
998090578 5:139365188-139365210 AAAAAATACAAAATTTGGCCAGG + Intronic
998239709 5:140429079-140429101 AAAAAAAAAAATTCTAGGCCGGG - Intronic
998285939 5:140861022-140861044 AAAAAAAATACCTTTCGGCCGGG - Intronic
998502991 5:142649700-142649722 TAAAAACAAAATGTCCGGCCGGG - Intronic
998931494 5:147186262-147186284 AAAAAAAAAAATTGTCGGCTGGG - Intergenic
999050296 5:148516611-148516633 AAAAAAGGGAATTTTTGGCCAGG - Intronic
999091810 5:148942539-148942561 AAAAAGCACAATATTCGGGTGGG - Intronic
999163925 5:149531550-149531572 AAAAAAATCAATTTTGAGCCAGG + Intronic
999213496 5:149911856-149911878 AAAAAAAAAAATTATTGGCCAGG + Intronic
999221642 5:149984362-149984384 TAAAAAAACTGTTTTCGGCCAGG + Exonic
999278050 5:150345412-150345434 AAAAAGAAAAATTTTAGGCCAGG - Intergenic
999598282 5:153230884-153230906 AAATAACACAATTTTCTGACTGG - Intergenic
999783804 5:154873062-154873084 AAAATACAAAAAATTCGGCCAGG - Intronic
999792438 5:154953979-154954001 AAAAAAAAAAGTTTTAGGCCAGG - Intronic
999907901 5:156163723-156163745 AAAAGAAATCATTTTCGGCCGGG + Intronic
1000056410 5:157610702-157610724 CAAAAACACGATTTCAGGCCAGG - Intergenic
1000083055 5:157865378-157865400 AAAAAACAATATTTAAGGCCGGG + Intergenic
1000143072 5:158425644-158425666 AAAAACCACAATTTGAGGCCAGG + Intergenic
1000158893 5:158580446-158580468 AAACAAAACAATTATCAGCCAGG - Intergenic
1000706240 5:164515769-164515791 AGAAAACACAATTTTCTCTCTGG + Intergenic
1000845115 5:166269949-166269971 AAAAAATACATCTTTTGGCCAGG - Intergenic
1000940423 5:167353800-167353822 ATAAAACACCATATACGGCCGGG - Intronic
1001488840 5:172141279-172141301 AGAAAATACAATTTAGGGCCAGG + Intronic
1001613516 5:173023150-173023172 AAAAATCATCATTTGCGGCCAGG - Intronic
1001647447 5:173292802-173292824 ATAAAACACTAAATTCGGCCAGG + Intergenic
1001857363 5:175024757-175024779 AAGAAAAACAACTTTCGGCCAGG - Intergenic
1001904691 5:175461926-175461948 AAAAAAGAAAATTTGGGGCCAGG + Intergenic
1002032463 5:176440492-176440514 AAAAAAGACAATCCTTGGCCGGG - Intergenic
1002093974 5:176820100-176820122 AAAATACAAAATGTTGGGCCGGG + Intronic
1002119724 5:176993187-176993209 AAAAAAAAAAATTCTTGGCCGGG + Intronic
1002143454 5:177159882-177159904 AAAAAAAAATATATTCGGCCGGG - Intronic
1002377583 5:178799243-178799265 GAAAAGCACCACTTTCGGCCGGG + Intergenic
1002492522 5:179588889-179588911 AAAAAACACAAAAATCAGCCAGG - Intronic
1002511891 5:179725692-179725714 AAAAAAAAAAATTGTTGGCCAGG + Intronic
1002513359 5:179738004-179738026 AAGAAAATCAACTTTCGGCCAGG - Intronic
1002652227 5:180707369-180707391 AAAAAACAAAATATGGGGCCGGG + Intergenic
1002713376 5:181208969-181208991 AAAAAAAACATCTTTCGGCCGGG + Intergenic
1002725841 5:181295471-181295493 AAAAAACAAAATTCCTGGCCAGG - Intergenic
1002731072 5:181331961-181331983 AAAAAACAAAACTTGAGGCCTGG - Intergenic
1002753462 6:142143-142165 AAAAAACAAAACTTGAGGCCTGG + Intergenic
1002965190 6:1958099-1958121 AAAAAACATATTTTAAGGCCAGG - Intronic
1003034450 6:2631061-2631083 AAAAATAACAATTTTTGACCAGG - Intronic
1003132266 6:3404963-3404985 AAAAAAAAGATTTGTCGGCCAGG + Intronic
1003154305 6:3578341-3578363 AAAAAATACATCTATCGGCCAGG - Intergenic
1003206241 6:4015307-4015329 AAAAAAAACAAGATCCGGCCAGG + Intergenic
1003327734 6:5105515-5105537 AAAAAATACAAACTTCGGTCGGG + Intronic
1003575858 6:7293707-7293729 AAAAAATACAATATTTGGCCAGG - Intronic
1003666471 6:8116220-8116242 AAAAAAAAGAAATTGCGGCCGGG + Intergenic
1003841043 6:10119644-10119666 AAAAATCAAAATATTGGGCCAGG + Intronic
1004120617 6:12818116-12818138 AAAAATTACAATTTAAGGCCGGG - Intronic
1004203334 6:13570211-13570233 AAAGAACAGAAATTTCAGCCGGG + Intergenic
1004227279 6:13797726-13797748 AAAAAACACACTTGCCGGCCAGG + Intronic
1004405005 6:15324635-15324657 AAAAAACACAAAAATCAGCCAGG - Intronic
1004546073 6:16599415-16599437 AAAAAAAACAAGCTTAGGCCGGG + Intronic
1004598985 6:17129547-17129569 AAAAAAAAAAATTGTTGGCCAGG + Intronic
1004623011 6:17347814-17347836 AAAAAATATATATTTCGGCCGGG - Intergenic
1004847157 6:19656876-19656898 AAGAAACATAATTCTAGGCCGGG - Intergenic
1004914747 6:20321144-20321166 AAAAAACAAAATTTTCAGGGTGG - Intergenic
1004943387 6:20585345-20585367 AAAAAACAAGATTATCGGCCGGG - Intronic
1005064525 6:21805593-21805615 AAAAAGTACAATTTTTGGCCAGG + Intergenic
1005077570 6:21923630-21923652 AAAAAACACACTTCCCAGCCAGG - Intergenic
1005343304 6:24864004-24864026 AAAAAACATTATTCTAGGCCGGG + Intronic
1005446286 6:25926769-25926791 TAAAAACACATGTATCGGCCGGG + Intronic
1005492215 6:26357422-26357444 AAAAAAAAAAAGTTTTGGCCGGG - Intergenic
1005577229 6:27201242-27201264 AAAAAATACAAGATTCAGCCAGG - Intergenic
1005830296 6:29665389-29665411 AAAAATCACAAATATTGGCCAGG - Intronic
1005833849 6:29692699-29692721 AAAAAAAAAAAATTGCGGCCGGG - Intergenic
1005948714 6:30615335-30615357 AAAAAGAACAATTTTCTGCAGGG + Intronic
1005955973 6:30663729-30663751 AAAAAAAAAAATTTCAGGCCAGG + Intronic
1005981475 6:30840118-30840140 AAAAATCACAACTTTAGGCTGGG + Intergenic
1006135637 6:31894575-31894597 CTAAAAAACAATTTTAGGCCAGG - Intronic
1006199018 6:32269674-32269696 AAAAAAAAAAATTTTTGGCAGGG - Intergenic
1006345313 6:33476476-33476498 AAAAATTAAAATTTTAGGCCGGG + Intergenic
1006466740 6:34199880-34199902 ATAAAAGAAAATTTTTGGCCAGG + Intergenic
1006533560 6:34678550-34678572 AAAAAAAAGAAATTTCAGCCAGG + Intronic
1006613268 6:35308375-35308397 AAAAAAAAAAAGTTTTGGCCGGG + Intronic
1006616485 6:35331512-35331534 AAAAATCACAAATTTGGGCCAGG + Intergenic
1006757706 6:36431109-36431131 TAAAATGACAATTTACGGCCAGG - Intronic
1006944372 6:37775248-37775270 AAAAAAAAAAATCTTAGGCCAGG - Intergenic
1006954906 6:37860164-37860186 AAAAAAAACTCTTTTTGGCCTGG - Intronic
1007020870 6:38520156-38520178 AATACACAAAATTGTCGGCCAGG + Intronic
1007463834 6:42037735-42037757 AAAAAACAAAAGTTCTGGCCAGG + Intronic
1007547234 6:42703806-42703828 TAAAAAAACAATTGTCGGTCGGG + Intronic
1007773621 6:44210579-44210601 ATAAAACATAATTATTGGCCAGG - Intergenic
1008149296 6:47931078-47931100 ATAAAACACAATGCTCGGCCGGG - Intronic
1008285937 6:49650488-49650510 AAAATACACAATGTTTGGCATGG + Intergenic
1008483069 6:52006670-52006692 AAAAAATATATTTTTCAGCCAGG - Intronic
1008585271 6:52943107-52943129 AAAAAAAACCATTCTTGGCCTGG - Intergenic
1008606898 6:53149372-53149394 AAAATATACAATTCTTGGCCGGG + Intergenic
1008650732 6:53559283-53559305 AAAAAAAAAAACTTTCAGCCGGG + Intronic
1008902764 6:56641289-56641311 AAAAATGACACTTTTTGGCCAGG + Intronic
1009414524 6:63400696-63400718 ATAAAACATAAATTTCGGCCGGG + Intergenic
1009418161 6:63438115-63438137 AAAAGAAACTATTTTTGGCCAGG + Intergenic
1009425518 6:63509358-63509380 AAAAAATAGTATTTTTGGCCAGG - Intergenic
1010220287 6:73442890-73442912 ACAAAAAAAAATTTTAGGCCAGG - Intronic
1010233349 6:73554667-73554689 AAAAAACATAATTTATGGCCGGG - Intergenic
1010383318 6:75248955-75248977 AAAAGACAGAATTTTGGGCCGGG + Intronic
1010548127 6:77184044-77184066 AAAGAAAACAAGTTTCTGCCTGG + Intergenic
1010548307 6:77186599-77186621 GAAAAAAACAGTTTTGGGCCAGG + Intergenic
1010645559 6:78384344-78384366 AATAAACAAAATTTTCAGTCAGG + Intergenic
1010813210 6:80324065-80324087 ATAAAAAATAATTTTGGGCCGGG - Intronic
1010881487 6:81178924-81178946 AAAAAAAAAAAATTTAGGCCAGG + Intergenic
1010950035 6:82024887-82024909 AAAAACAACAATTTTCAGCAAGG - Intergenic
1010983757 6:82398857-82398879 AAAAAACAAAATTTTAGGTCAGG - Intergenic
1011036577 6:82983144-82983166 AAAAAAAAAAACTTTCAGCCAGG - Intronic
1011074811 6:83427714-83427736 AAAAAATACAACTTATGGCCGGG + Intronic
1011101289 6:83725633-83725655 AAAAAAAACAATTTTGGGCATGG + Intergenic
1011289840 6:85765641-85765663 AAAAAACAGGAATTTAGGCCTGG + Intergenic
1011583643 6:88900844-88900866 AAAAAAAAAAATTTTAGGCCAGG + Intronic
1011608241 6:89125788-89125810 AAAAAAAAAAATTCTCAGCCAGG + Intergenic
1011683428 6:89804734-89804756 AAAATACAAAATTCTAGGCCGGG + Intronic
1011687416 6:89834721-89834743 AAAAAACAAATTTTGAGGCCAGG - Intronic
1011895465 6:92219140-92219162 ATAAGATACAATTTTAGGCCAGG + Intergenic
1012853096 6:104470251-104470273 AAAACAATCAATTTCCGGCCAGG - Intergenic
1012981372 6:105833422-105833444 ATTAAAAACATTTTTCGGCCAGG - Intergenic
1013132051 6:107242537-107242559 AAAAATAATAATTTTTGGCCAGG - Intronic
1013133124 6:107254325-107254347 AAAAAAATTATTTTTCGGCCAGG - Intronic
1013152257 6:107458188-107458210 AAAAAAAAAAACTTTTGGCCGGG + Intronic
1013222833 6:108094748-108094770 AAAAAAAAAAATTATTGGCCAGG - Intronic
1013497718 6:110715027-110715049 TGAAAAGACATTTTTCGGCCAGG - Intronic
1013540207 6:111100676-111100698 AAAAAAGACAACTGTAGGCCGGG - Intronic
1014037144 6:116779603-116779625 AAAAAATATATTTTACGGCCGGG - Intergenic
1014040363 6:116818237-116818259 AAAGAAAAGAATTTTCGGCCGGG + Intronic
1014090085 6:117394746-117394768 AAACAACACAATTTGCAGACAGG + Intronic
1014140928 6:117940942-117940964 AAAAACCACATCTTTGGGCCAGG - Intronic
1014225101 6:118838714-118838736 AAAGAAAAGAATTTTCGGCCGGG - Intronic
1014464839 6:121742697-121742719 AAGAAATACATTTTTCAGCCAGG - Intergenic
1014638882 6:123883680-123883702 AAAAAAAAAAATTACCGGCCAGG + Intronic
1015002204 6:128231902-128231924 AAACAAAACGATTTTGGGCCTGG - Intronic
1015030117 6:128584916-128584938 AAAAAACATAATTAAGGGCCGGG - Intergenic
1015071055 6:129093282-129093304 AAAAAAAAAAATCCTCGGCCGGG - Intronic
1015098512 6:129446664-129446686 AAAAAACAGAATTTTTGACATGG - Intronic
1015123139 6:129722880-129722902 AAAAACCTCAATTATGGGCCAGG - Intergenic
1015144778 6:129973205-129973227 AAAATACAAAAATTTCGGCCGGG - Intergenic
1015399879 6:132777058-132777080 AAAAAACACAAAAATCAGCCTGG + Intronic
1015579626 6:134709708-134709730 AGAAATCACAGTTTCCGGCCGGG + Intergenic
1015645775 6:135386603-135386625 AAAAAACACTTTTCTAGGCCAGG - Intronic
1015804824 6:137098270-137098292 AAAAAACATCATTCTTGGCCAGG - Intergenic
1016475361 6:144421392-144421414 ATAAAAGACAAATTTGGGCCGGG + Intronic
1016542669 6:145183093-145183115 AAAAAAAAAAATTTCGGGCCGGG + Intergenic
1016667090 6:146654645-146654667 AATATACACAATTTTTGGCCAGG - Intronic
1017103724 6:150868765-150868787 AGAAAAGACAAATTTAGGCCAGG + Intronic
1017263681 6:152417201-152417223 ATAAAACACAACTCTGGGCCAGG + Intronic
1017516285 6:155158714-155158736 AAAAAACACAAAACTCAGCCAGG - Intronic
1017679792 6:156852150-156852172 AAAAAAAAAAATTTGAGGCCGGG + Intronic
1017833304 6:158152218-158152240 AGAAAACACAAAGTTCAGCCAGG + Intronic
1017896019 6:158680589-158680611 AAAAAACACAAAAATCAGCCAGG + Intronic
1018283802 6:162216233-162216255 TAAAAACCCAGTTTGCGGCCGGG + Intronic
1018381577 6:163262744-163262766 ACAAAATACAAATTTAGGCCAGG + Intronic
1018533030 6:164787684-164787706 AAAAAGCACAATATTCGGGTGGG + Intergenic
1018571179 6:165211698-165211720 AATAAATACACTTTTTGGCCGGG + Intergenic
1018631088 6:165823125-165823147 AAAAAAAAAAATTATAGGCCGGG - Intronic
1018984211 6:168623629-168623651 AAAAAAAATAATTATTGGCCAGG - Intronic
1019136325 6:169910727-169910749 AAAAAATACAATTTATGGCTGGG - Intergenic
1019202181 6:170327037-170327059 AAAAAATTCAAGTTTTGGCCTGG - Intronic
1019479302 7:1259223-1259245 ATAAAACACATTTTTAGGCCGGG - Intergenic
1020031457 7:4935887-4935909 AAAATAAAAAATTTTGGGCCGGG + Intronic
1020122078 7:5510331-5510353 AAAAAACCCAAGTTGCAGCCTGG + Intronic
1020133612 7:5573854-5573876 TAAAAACACAAAATTAGGCCGGG - Intergenic
1020178735 7:5904535-5904557 AAAAAAAAAAATTTTTGGCCAGG + Intronic
1020209512 7:6148175-6148197 AAAAAATACAAGTATCAGCCGGG + Intronic
1020304193 7:6820470-6820492 AAAAAAAAAAATTTTTGGCCAGG - Intronic
1021150491 7:17145042-17145064 AAAAAAAACAGTTTTAGCCCAGG - Intergenic
1021166186 7:17345019-17345041 TTAAAATACAATTTTTGGCCGGG + Exonic
1021439875 7:20665872-20665894 AAAAAAAAAAATGTTGGGCCGGG + Intronic
1021454084 7:20810626-20810648 AAAAGTAACAATTTTTGGCCGGG - Intergenic
1021457089 7:20841398-20841420 TAAAAACACAACTCTCGGCCAGG - Intergenic
1022110960 7:27231263-27231285 AAAATACAAAAATTTAGGCCAGG + Intergenic
1022204130 7:28147139-28147161 AAAAATCAGAATTCTGGGCCAGG - Intronic
1022325907 7:29331764-29331786 AAGAAATACAATTTGGGGCCAGG + Intronic
1022378443 7:29837058-29837080 AAACAACACACATTTTGGCCGGG + Intronic
1022405206 7:30082870-30082892 AAAAAACTTAATTTTCCTCCAGG - Exonic
1022718306 7:32918945-32918967 AAAATTCACAATTATGGGCCGGG + Intergenic
1022722495 7:32953709-32953731 AAAAAAAACAACTTACGGCCAGG - Intergenic
1022916227 7:34956796-34956818 TAAAAACCCATTTTTCGGCCAGG - Intronic
1022996448 7:35760331-35760353 CAAAGACACAATTTTAGGCATGG - Intergenic
1023073910 7:36464072-36464094 AAAGAAAACAATTTACAGCCAGG - Intergenic
1023181711 7:37491490-37491512 AAAAAACATAATTTTAGGCCGGG - Intergenic
1023368213 7:39486329-39486351 AAAAAAAAAAATTCTGGGCCAGG - Intronic
1023402231 7:39798503-39798525 AAAAAACAAAACTTGAGGCCTGG - Intergenic
1023441919 7:40193264-40193286 AAAAAACACAGTAATTGGCCAGG - Intronic
1023810711 7:43909429-43909451 AAAAACCAGTATTTTAGGCCAGG + Intronic
1023914266 7:44576850-44576872 AAAAAATGCAATTTAGGGCCAGG - Intergenic
1023949754 7:44833644-44833666 TAAAATCCCAATTTTTGGCCTGG - Intronic
1024060653 7:45696141-45696163 AAAAATCCAGATTTTCGGCCGGG + Intronic
1024070730 7:45783044-45783066 AAAAAACAAAATTCCTGGCCAGG - Intergenic
1024179118 7:46871168-46871190 AAAATATACAAATTTGGGCCTGG - Intergenic
1024787222 7:52922199-52922221 AAATAACAAAATTATCAGCCGGG - Intergenic
1024992631 7:55248203-55248225 AAAAAACAAAATTTTGGGCCGGG + Intronic
1025005711 7:55353097-55353119 AAAAAAAAAAATTGTGGGCCAGG + Intergenic
1025012086 7:55405647-55405669 AAAAAAAAAAAGTTCCGGCCAGG - Intronic
1025076861 7:55951332-55951354 AAAAAAAACACTTTTAGGCCAGG + Intergenic
1025135851 7:56411956-56411978 AAAAAAAATAATATTTGGCCAGG + Intergenic
1025165976 7:56712751-56712773 AAATAAAACAATTTTGAGCCTGG - Intergenic
1025169533 7:56743779-56743801 AAAATACAAAATTAGCGGCCAGG - Intergenic
1025176569 7:56805210-56805232 AAAAAACAAAACTTGAGGCCTGG + Intergenic
1025695223 7:63771176-63771198 AAAAAACAAAACTTGAGGCCTGG - Intergenic
1025702362 7:63831934-63831956 AAAATACAAAATTAGCGGCCGGG + Intergenic
1025728687 7:64090860-64090882 AACAAACAAAATTTAAGGCCAGG - Intronic
1025732082 7:64116065-64116087 AAAAAACACAAAAGTTGGCCAGG - Intronic
1025773607 7:64537630-64537652 AAAAAACAGAATAGACGGCCAGG + Intronic
1025867235 7:65394939-65394961 AAAAAACTTCATTTTGGGCCAGG - Intronic
1025991297 7:66499060-66499082 AAAAAACATTTTTTTTGGCCGGG - Intergenic
1026167089 7:67919965-67919987 AAAACACCCATTTTTTGGCCAGG + Intergenic
1026612561 7:71873301-71873323 ACAAAAAAAAATTTTCGGCTGGG - Intronic
1026617670 7:71920628-71920650 AAAAAACTAATTTGTCGGCCGGG - Intronic
1026666703 7:72346808-72346830 AAAATAAACAAATTTTGGCCGGG - Intronic
1027159922 7:75794838-75794860 AATAAAAACATGTTTCGGCCGGG + Intergenic
1027474561 7:78612963-78612985 AGAAAACGTCATTTTCGGCCTGG - Intronic
1027489387 7:78804451-78804473 AAAAAAAAAAACTTTGGGCCAGG + Intronic
1027520166 7:79197074-79197096 AAAAAACAAACTTCTGGGCCAGG - Intronic
1027768162 7:82372887-82372909 AATAAACACAATATCAGGCCAGG + Intronic
1027882319 7:83856328-83856350 AAAAAGCACAATTTTCCACCTGG - Intergenic
1027964338 7:84986851-84986873 AAAAAAAAAAATTTTAGGTCAGG + Intergenic
1028028412 7:85876239-85876261 AAACAAAACAATTATCAGCCAGG + Intergenic
1028212843 7:88096216-88096238 AAAAAAAAGTATTTTCAGCCAGG - Intronic
1028545280 7:91992366-91992388 ATAAAACTCAATTGTAGGCCAGG + Intronic
1028619604 7:92810775-92810797 AAAAAAAGCAATTATAGGCCGGG + Intronic
1029089523 7:98037302-98037324 AAAAAAAACTTTTTTGGGCCAGG - Intergenic
1029288679 7:99484766-99484788 AAAAAATACAAATTTAAGCCGGG + Intronic
1029417045 7:100449837-100449859 AAAAAAAATAATTTTAGGCCGGG - Intergenic
1029471129 7:100754935-100754957 AAATAAAACAATTTTAGGCTAGG - Intronic
1029478309 7:100798384-100798406 AAAATACATAATTTTGGGCCAGG - Intergenic
1029995694 7:105005929-105005951 AAAATACAGAACTTTTGGCCGGG + Intergenic
1030052803 7:105553706-105553728 AAAAAAGACAATTTACAGGCAGG - Intronic
1030290707 7:107869718-107869740 AAAAAATACCATTTGGGGCCTGG - Intergenic
1031903467 7:127435626-127435648 AAAACACACATTTTTTGGCCAGG + Intergenic
1032061456 7:128728647-128728669 AAAAATCAGAATATTTGGCCTGG - Intronic
1032112421 7:129087486-129087508 AAAAAAAATAAAATTCGGCCGGG + Intergenic
1032135270 7:129271065-129271087 AAAAAAAAAAAGTTTGGGCCGGG + Intronic
1032146113 7:129382608-129382630 AAAAAAAATAATTTTAGGCAGGG + Intronic
1032170075 7:129577399-129577421 AAAAAATAGAATTATAGGCCAGG - Intergenic
1032212465 7:129928305-129928327 AACAAACACAACTTATGGCCAGG + Intronic
1032220401 7:129990042-129990064 AAAAAAAAAAAATTCCGGCCAGG + Intergenic
1032269508 7:130390934-130390956 AAAAAAAACAATTTTAGGCTGGG + Intergenic
1032295719 7:130637008-130637030 AAAGAAAAGAATTTTCAGCCCGG - Intronic
1032357294 7:131222719-131222741 TAAAAATACAATTTCAGGCCGGG + Intronic
1032581893 7:133111277-133111299 AAAAATAACCATTTTAGGCCAGG - Intergenic
1032592053 7:133200559-133200581 AAAAAAGACCATTTTAGGCTTGG - Intergenic
1032624141 7:133571377-133571399 AAAAAAGAGAAATTTAGGCCAGG + Intronic
1032997158 7:137459767-137459789 AGAAAATAAAATTTTTGGCCGGG - Intronic
1033099365 7:138457399-138457421 AAGAAAATCATTTTTCGGCCAGG - Intergenic
1033132993 7:138761337-138761359 AAAACACACAAATTCAGGCCAGG + Intronic
1033310312 7:140256465-140256487 AAAAAACAGAAATTGGGGCCGGG - Intergenic
1033331954 7:140424148-140424170 AAAAAAAAAAATTATCAGCCAGG - Intronic
1033341907 7:140498782-140498804 AAAAAAAAAAATCTTAGGCCTGG + Intergenic
1033342433 7:140502563-140502585 AAAAAACAAAAAATTAGGCCGGG + Intergenic
1033470911 7:141647964-141647986 AAAATAAATAATTTTTGGCCAGG - Intronic
1033540235 7:142349585-142349607 AAAAAACAGAATTTCCTGCTGGG + Intergenic
1033691168 7:143739301-143739323 TAAAAAATCAATTCTCGGCCGGG - Intergenic
1033887364 7:145964597-145964619 AGAGAACACAAGTTTCTGCCTGG + Intergenic
1033892584 7:146033395-146033417 AAAAAATAGAATTTTTGGCCGGG + Intergenic
1034126587 7:148677004-148677026 AAAATACACAGTCTACGGCCGGG + Intergenic
1034171973 7:149069611-149069633 AAAAAAAAAAAATTTGGGCCAGG - Intergenic
1034194334 7:149234415-149234437 ACAAAAGACATTGTTCGGCCAGG + Intergenic
1034253350 7:149710166-149710188 AAAAAAAAAAAATTTAGGCCAGG - Intergenic
1034340469 7:150350441-150350463 AAAAAACTATATTTTCAGCCAGG - Intergenic
1034486663 7:151369301-151369323 GAAAAAGACAAGTTTCGGCCAGG - Intronic
1034631571 7:152534880-152534902 AAAAGAACCAATTTTTGGCCAGG + Intergenic
1034633111 7:152546174-152546196 AAAAAAAAAAATCTTAGGCCAGG - Intergenic
1034896452 7:154879283-154879305 TAAAAACACAAAAATCGGCCGGG + Intronic
1034896508 7:154879605-154879627 AAAAAACACAAAAATCAGCCAGG + Intronic
1035418981 7:158711446-158711468 AAAAAAAAAAATTCACGGCCGGG + Intergenic
1035946263 8:3966513-3966535 AAAGAATACAATTTTCTCCCAGG - Intronic
1036144646 8:6243687-6243709 AAAAAAAAAAAATCTCGGCCTGG + Intergenic
1036167288 8:6447842-6447864 AGAAAACAAAATTGTTGGCCGGG - Intronic
1036168179 8:6457442-6457464 AAAAAACACAAAAATTGGCCAGG + Intronic
1036395598 8:8367934-8367956 AAAAAACACTATATACGGCCAGG - Intronic
1036431071 8:8691211-8691233 AAAAAATATCATTTTTGGCCGGG + Intergenic
1036474866 8:9084086-9084108 AAAAAAAAAAATTTTAGGCTGGG - Intronic
1036526827 8:9542533-9542555 AAAAAATACACATTACGGCCGGG - Intergenic
1036531138 8:9588569-9588591 AAAAGAAACAATTTGGGGCCGGG - Intronic
1037253909 8:16929666-16929688 AAAAAATACAAATTCTGGCCAGG - Intergenic
1037276994 8:17191253-17191275 AAAATACAAAAATTTGGGCCAGG - Intronic
1037562838 8:20089953-20089975 TAAAAAGGCAATTTTAGGCCGGG - Intergenic
1038072671 8:24035114-24035136 AAAAAACACAATAATGGGCTGGG + Intergenic
1038548173 8:28442231-28442253 TAAAAATACAAATTCCGGCCGGG - Intronic
1038565584 8:28617621-28617643 AAAAAACACAAAAATCAGCCAGG + Intronic
1038799256 8:30734320-30734342 AAAAATCACCATTTTGGGCTGGG + Intronic
1039144928 8:34437192-34437214 AAACAAAACAATTATCAGCCAGG - Intergenic
1039329344 8:36519740-36519762 AAAAAACAACATTCTGGGCCGGG - Intergenic
1039381463 8:37089402-37089424 AAAAATCACCATTTTCGGCCGGG - Intergenic
1039502434 8:38028684-38028706 AAAAAAAATAAATTTCGGCTGGG - Intergenic
1039619570 8:38984315-38984337 TTAAAACACATTTTTCGGCTGGG + Intronic
1040047861 8:42981346-42981368 AAGAAACACTATTTTTGGCTGGG - Intronic
1040446025 8:47494281-47494303 AAAAAAAAAAATTCTAGGCCAGG - Intronic
1040658222 8:49538193-49538215 AAAAAACAAAATGTCCGGCCGGG + Intronic
1040699733 8:50047176-50047198 AAAAAACACAAATGTTAGCCAGG + Intronic
1040913112 8:52541470-52541492 AAAATAAAAAATTTTTGGCCGGG + Intronic
1041073236 8:54145473-54145495 AAAAAAAAAAATTTCTGGCCCGG - Intronic
1041276258 8:56161281-56161303 AAAATATACAAAATTCGGCCTGG + Exonic
1041693508 8:60713403-60713425 AAAAAAAAAAATTTCTGGCCGGG - Intronic
1041696806 8:60744555-60744577 AAAAAAAAGTATTTTAGGCCAGG + Intronic
1041821071 8:62033484-62033506 AAAAAAATCAATTTCCTGCCAGG + Intergenic
1042034430 8:64515887-64515909 AAAAAAAAAAAATTTGGGCCAGG - Intergenic
1042095061 8:65206155-65206177 AGAAAACACAATTTTCCAGCTGG + Intergenic
1042239085 8:66644800-66644822 AAAAAAAAAAATTTTAGGCCAGG + Intronic
1042368192 8:67960335-67960357 AAAAAAAACCACTTCCGGCCGGG - Intronic
1042540648 8:69904291-69904313 AAAAAAAAAAATTGTGGGCCAGG - Intergenic
1042548402 8:69971538-69971560 TAAAAACAAAATTTTTGGCCAGG - Intergenic
1043040944 8:75261037-75261059 AAACAAAACAATTATCAGCCAGG + Intergenic
1043050553 8:75380066-75380088 AAAAATCACAATTTTTAGTCAGG - Intergenic
1043581994 8:81725046-81725068 AAACAACACAAATTTAGGCTGGG + Intronic
1044348798 8:91139244-91139266 TAAAAATAAAAGTTTCGGCCGGG + Intronic
1044830179 8:96239963-96239985 AAAAAAGCAAATCTTCGGCCGGG + Intronic
1045029978 8:98125833-98125855 AAAAAGCAAAATTTCCAGCCAGG - Intronic
1045075908 8:98567760-98567782 AAAAATTATAATTTTAGGCCAGG + Intronic
1045319816 8:101073619-101073641 AAAAATAAAAATTTTGGGCCGGG - Intergenic
1045331856 8:101162169-101162191 AAAATACAAAAATTTGGGCCAGG - Intergenic
1045863704 8:106841095-106841117 AAAAAACAACATTATAGGCCAGG - Intergenic
1045864714 8:106851951-106851973 AAAAAAAAAAATTACCGGCCGGG - Intergenic
1046004864 8:108466747-108466769 AAAAAAGACCAATTTTGGCCAGG - Intronic
1046381737 8:113460170-113460192 AAAAATAAAAATTTGCGGCCGGG + Intergenic
1046503402 8:115107979-115108001 AAAAAGCTGAATTTTAGGCCAGG + Intergenic
1046605149 8:116363468-116363490 CACACACACAATTTTCAGCCTGG + Intergenic
1046643948 8:116764812-116764834 TTAAAACAAAGTTTTCGGCCGGG - Intronic
1047261478 8:123264852-123264874 AAAAAACAAAGTTTGTGGCCAGG - Intronic
1047380871 8:124361536-124361558 AAAAAGCAAGATTTTGGGCCGGG + Intronic
1047386914 8:124418260-124418282 AAAAAATACAAATATTGGCCAGG + Intergenic
1047479842 8:125271098-125271120 AAAAAACACAAAATTTTGCCAGG + Intronic
1047494587 8:125400474-125400496 AAAAAAAAAAATTCTAGGCCAGG + Intergenic
1048921686 8:139237223-139237245 AAAAAAAAGAATTATAGGCCAGG - Intergenic
1049295812 8:141836676-141836698 AAACAAAACAATTATCAGCCAGG - Intergenic
1049759302 8:144324770-144324792 AAAAATCTCAATTCCCGGCCGGG + Intronic
1049901752 9:175081-175103 AAAAAAAACATTTTTTCGCCAGG + Intronic
1049932188 9:468199-468221 AAAAAACTAAATTTCTGGCCAGG + Intergenic
1049974034 9:845015-845037 AAAAAACACAACTACAGGCCGGG - Intronic
1050355359 9:4777808-4777830 AAAACACATAACTTTTGGCCAGG + Intergenic
1050655013 9:7818443-7818465 AAGAAATAAAATTGTCGGCCGGG - Intronic
1050864573 9:10482074-10482096 AAAAAAAACAAATGTTGGCCGGG + Intronic
1050962352 9:11750922-11750944 AGAAAATACAATTTTCGACTAGG - Intergenic
1051262395 9:15277130-15277152 AAAAAACATAATTTATGGGCTGG + Intronic
1051702871 9:19843203-19843225 AAAAAAAATAATTTTGGGCCAGG + Intergenic
1052613568 9:30808856-30808878 AACAAACAGTATTTTAGGCCAGG + Intergenic
1052910187 9:33873940-33873962 AAAAAAAAAAAATTTAGGCCAGG - Intronic
1052946036 9:34168942-34168964 AAAAAATACAAAATTAGGCCAGG - Intergenic
1052979900 9:34440553-34440575 AAAAAAAACAATTTTTGGCCAGG + Intronic
1053212518 9:36243034-36243056 ACAAAACACTAGTTTTGGCCAGG - Intronic
1053238053 9:36473689-36473711 TAAAAACTCAATTTTTGTCCAGG + Intronic
1053266813 9:36721206-36721228 AAAAAATACAAAATTAGGCCTGG + Intergenic
1053579615 9:39391059-39391081 AAAATACACAAATTTAGGCTGGG + Intergenic
1053586396 9:39463570-39463592 ATAAATCAGAATTTTTGGCCAGG - Intergenic
1053601278 9:39612315-39612337 AAAAATGATATTTTTCGGCCAGG + Intergenic
1053744786 9:41185376-41185398 AAAAAAGACATTTTTTGGCCAGG + Intronic
1053844129 9:42219139-42219161 AAAATACACAAATTTAGGCCGGG + Intergenic
1054101202 9:60949868-60949890 AAAATACACAAATTTAGGCTGGG + Intergenic
1054122575 9:61225231-61225253 AAAATACACAAATTTAGGCTGGG + Intergenic
1054252259 9:62730123-62730145 AAAAATGATATTTTTCGGCCAGG - Intergenic
1054482484 9:65679847-65679869 AAAAAAGACATTTTTTGGCCAGG - Intronic
1054566374 9:66764622-66764644 AAAAATGATATTTTTCGGCCAGG - Intergenic
1054579908 9:66901647-66901669 ATAAATCAGAATTTTTGGCCAGG + Intronic
1054585150 9:66957012-66957034 AAAATACACAAATTTAGGCCGGG - Intergenic
1054683562 9:68245892-68245914 AAAAAAGACATTTTTTGGCCAGG - Intronic
1055028612 9:71749408-71749430 AAAAAAAAAAACTTGCGGCCGGG + Intronic
1055108156 9:72533835-72533857 TAAAAATACAATTTCTGGCCAGG + Intronic
1055219579 9:73912656-73912678 AAAAAATATAATTCTGGGCCAGG + Intergenic
1055265011 9:74485396-74485418 AGAAAAAACAATTCTTGGCCAGG + Intergenic
1055495382 9:76849528-76849550 AAAAACTATAATTTTAGGCCAGG + Intronic
1055596120 9:77866180-77866202 AAAAAACAAAAATTTAGGCCGGG + Intronic
1055724832 9:79216477-79216499 AAAAAATCCAATTTATGGCCAGG - Intergenic
1055873393 9:80913602-80913624 AAGAAACAAAATTTTTGGTCCGG - Intergenic
1055923238 9:81483811-81483833 AAAAATCTCAATTTACGGCCGGG + Intergenic
1056106699 9:83354219-83354241 ATAAGACAGAATTTTTGGCCAGG - Intronic
1056146645 9:83737703-83737725 AAAATACAGGATTTTAGGCCAGG - Intergenic
1056246329 9:84699028-84699050 AAAAAAAAAAATTTTCAGCAAGG - Intronic
1056335144 9:85561074-85561096 AAAAGAGACCATTTTCGGCCGGG + Intronic
1056443965 9:86646755-86646777 AAAAAAGAAAACTTTAGGCCAGG + Intergenic
1057014148 9:91635631-91635653 AAGAAATATAATTTTGGGCCAGG + Intronic
1057106076 9:92418380-92418402 AAAAAAAAAAAATCTCGGCCAGG - Intronic
1057108213 9:92441596-92441618 AAAAAACACAAAAGTCAGCCTGG + Intronic
1057177176 9:93008967-93008989 AAAAAAAAAAAGTTTTGGCCAGG + Intronic
1057396421 9:94684346-94684368 AGAAAAGACAATGTTAGGCCGGG - Intergenic
1057456451 9:95217188-95217210 TAAAAACACATTTCTAGGCCGGG + Intronic
1057508206 9:95654148-95654170 AAAAAAAAGAACCTTCGGCCGGG - Intergenic
1057508255 9:95654451-95654473 TAAAAACAGAATCTTCGGCTGGG - Intergenic
1057585640 9:96326506-96326528 AAAAAATCTAAGTTTCGGCCAGG + Intronic
1057587983 9:96346839-96346861 AAAAAAAAGGATTTTTGGCCAGG + Intronic
1057774837 9:97999100-97999122 AAAAGCCACCACTTTCGGCCGGG - Intronic
1057901013 9:98948301-98948323 TAAAGACACACTTGTCGGCCGGG + Intronic
1058357292 9:104097399-104097421 TAAAAACAAAATCTTGGGCCAGG - Intronic
1058768653 9:108208708-108208730 AAAAAATACAAAATTTGGCCAGG - Intergenic
1058863032 9:109135932-109135954 ATATAACACATTTTTAGGCCAGG + Exonic
1058995047 9:110291562-110291584 AAAAAAAAAAATTTTGGGCGTGG - Intergenic
1059130400 9:111741925-111741947 TAAAAATAAAATTTTGGGCCAGG - Intronic
1059131643 9:111757395-111757417 TAAAAAAACATTTTTTGGCCGGG - Intronic
1059146418 9:111903754-111903776 AAAAAACACAAAAATCAGCCAGG - Intronic
1059782468 9:117544162-117544184 AAGAAATACATTTTTGGGCCAGG + Intergenic
1059971578 9:119674121-119674143 AAAGAAGAAAATTTTTGGCCAGG - Intergenic
1059981042 9:119772395-119772417 AAAACACATAATTTTAGGCAGGG + Intergenic
1060171321 9:121463682-121463704 ACAAAACAGAATTTGAGGCCAGG - Intergenic
1060627629 9:125128011-125128033 AAAAAAAAAAATTCTAGGCCAGG + Intronic
1060628502 9:125135354-125135376 AAAAATCATAATTTTAGGCCAGG + Intronic
1060673469 9:125491146-125491168 AAAAAAAAAAAATTTAGGCCAGG + Intronic
1061023095 9:128029444-128029466 AAAAAATATATTTTTGGGCCAGG + Intergenic
1061109688 9:128560028-128560050 AAAAATCAAAATTATCGGCCAGG - Intronic
1061197987 9:129118668-129118690 AAAAAAAAAAATTTTAGGCGGGG - Intronic
1061289608 9:129643025-129643047 AAAATACACAAGATTCGGGCTGG - Intergenic
1061407680 9:130401616-130401638 AAAAATCACCATGTTAGGCCAGG - Intronic
1061688570 9:132305052-132305074 ATAAAAAACTATTTTGGGCCAGG + Intronic
1061722731 9:132562991-132563013 AAAAAACCCCAATTGCGGCCAGG - Intronic
1061780446 9:132993002-132993024 AAAAAACACAGATATGGGCCAGG + Intergenic
1061891262 9:133621708-133621730 AAAAAACAGAAATCTTGGCCGGG - Intergenic
1062066785 9:134532620-134532642 AAAACATACAATTTGTGGCCGGG + Intergenic
1062361134 9:136188751-136188773 TAAAAATAAAATTTTGGGCCGGG + Intergenic
1062515953 9:136936010-136936032 AAAGAACACAATCCTCAGCCGGG + Intronic
1062654672 9:137597160-137597182 AAAAAACAAAAATTAGGGCCAGG + Intergenic
1062714738 9:138003089-138003111 AAAAAAAAGAAATTTGGGCCAGG - Intronic
1062750977 9:138253115-138253137 AAAAAACAAAATTCCTGGCCAGG - Intergenic
1062755477 9:138284468-138284490 AAAAAACAAAACTTGAGGCCTGG - Intergenic
1203579392 Un_KI270745v1:28640-28662 AAAAAACAAAACTTGAGGCCTGG - Intergenic
1185453541 X:295820-295842 AAACAAAAAAATTTTCCGCCTGG - Intronic
1185493000 X:533355-533377 AAATAATACCAATTTCGGCCGGG - Intergenic
1185783718 X:2871391-2871413 AAAAAAAAAAATTCTAGGCCAGG + Intronic
1185890929 X:3821427-3821449 AAAAAATACAAAAATCGGCCTGG + Intronic
1186141868 X:6583994-6584016 AAAAAAAAGAATTTTAGTCCTGG - Intergenic
1186175828 X:6925017-6925039 AATAAATACAATTTAAGGCCGGG + Intergenic
1186421203 X:9428021-9428043 AAAAAACACTTTTTGTGGCCAGG + Intergenic
1186842233 X:13495543-13495565 AAAAGACACTATGTTCTGCCAGG + Intergenic
1187063162 X:15807583-15807605 ATAAAACACAATGCTAGGCCGGG - Intronic
1187126720 X:16461197-16461219 AAAAAACATAATTTGAGGCCAGG - Intergenic
1187167289 X:16815818-16815840 AAAAAAAAAAAATTTCGGACAGG - Intronic
1187225671 X:17374050-17374072 AAAAACCAAAATTTTCGGCAAGG - Intergenic
1187331806 X:18347454-18347476 AAAAAGAACATTTTTAGGCCGGG + Intronic
1187342459 X:18433254-18433276 AAAAAATACACTTCTCGGCCGGG + Intronic
1187466189 X:19529945-19529967 AAAAAAAAAAAGTTTAGGCCGGG - Intergenic
1187520138 X:20005807-20005829 AGAAAGCACAATTATGGGCCGGG - Intergenic
1187643722 X:21323099-21323121 AAACAACCCAATTTTTGGCCTGG - Intergenic
1187739307 X:22338220-22338242 AAAAAAGTAAATATTCGGCCAGG - Intergenic
1187897607 X:23997440-23997462 AAAAAATAAAATTTTTGGCCAGG + Intronic
1187970378 X:24652786-24652808 TGAAAACATTATTTTCGGCCAGG + Intronic
1188031439 X:25268460-25268482 AAAAAAAAGAATTCACGGCCAGG - Intergenic
1188220766 X:27538684-27538706 AAAAAATAAATTTTTGGGCCGGG - Intergenic
1188776249 X:34222823-34222845 CAAACACACAATTTTCTTCCTGG - Intergenic
1188824431 X:34812851-34812873 AAAGAATAAAATTTTTGGCCAGG - Intergenic
1188854143 X:35171588-35171610 AAAAAACAAAAGTCTCTGCCTGG - Intergenic
1188899714 X:35715001-35715023 AAAAAATAAAATTGTCAGCCAGG + Intergenic
1189330763 X:40143659-40143681 AAAAAACAAATCTTTTGGCCAGG + Intronic
1189419126 X:40840829-40840851 AAAAAAAAAAACTTTAGGCCAGG + Intergenic
1189438497 X:41013547-41013569 AAAAAAAAGAATTTTCTGGCTGG + Intergenic
1189442420 X:41049228-41049250 AAAAAACAAATTATTGGGCCGGG + Intergenic
1189947861 X:46198142-46198164 AATAAAAATAATTTTTGGCCGGG + Intergenic
1190271728 X:48869520-48869542 AAAGAAAAGAATTTTCTGCCGGG + Intergenic
1190313852 X:49136907-49136929 AAGAAAAACAAATTTAGGCCAGG + Intergenic
1190821692 X:53979083-53979105 AAAAAATAAAATTTCAGGCCAGG + Intronic
1190889753 X:54557884-54557906 AAAAAAAAAAATTTTCTGGCAGG - Intronic
1191852069 X:65592742-65592764 TAAAAACACAATTTTGAGGCTGG + Intronic
1192367730 X:70488303-70488325 AAAAAAGCTAATTATCGGCCGGG - Intronic
1192427935 X:71093889-71093911 AAAAAACAAAATTTATAGCCAGG + Intergenic
1192442129 X:71182436-71182458 AAAAAGCACAATTTCCGTACAGG + Intergenic
1192569849 X:72194237-72194259 AAAAAATACAAAATTAGGCCGGG + Intronic
1192572127 X:72214689-72214711 ACAAAACAAAAGTTTAGGCCAGG + Intronic
1192630328 X:72772855-72772877 AAAAAACAAAATCTTCAGGCCGG - Intergenic
1192651382 X:72947949-72947971 AAAAAACAAAATCTTCAGGCCGG + Intergenic
1192745608 X:73935390-73935412 AAAAAAACCTATTTTGGGCCAGG - Intergenic
1192783216 X:74314773-74314795 TGAAAACACAATTGTCGGCCGGG - Intergenic
1192815239 X:74583750-74583772 ACAAAAAACAATTTGCGGCCGGG + Intergenic
1192819176 X:74625696-74625718 AAAATACAGAATGTTTGGCCTGG + Intergenic
1192832087 X:74761163-74761185 AAAAAATAAAACTTTGGGCCAGG - Intronic
1192850344 X:74949289-74949311 AAAAAACACAACTTTAGTGCAGG + Intergenic
1193084770 X:77439131-77439153 AAAAAACTCTAATTTTGGCCGGG - Intergenic
1193121963 X:77832533-77832555 AAGAAAATCAATTTTCGGCCGGG + Intronic
1193142948 X:78047864-78047886 AAAAAATACAAATTTAGGCTGGG - Exonic
1193272916 X:79549732-79549754 CAAGAACACAAAGTTCGGCCGGG - Intergenic
1193697153 X:84723349-84723371 AGAAAACAAAAGTTTCTGCCTGG - Intergenic
1193769124 X:85567928-85567950 AAAGAAAAGAATTTTCAGCCCGG - Intergenic
1194074138 X:89367691-89367713 AAAAGGCACATTTTTGGGCCAGG - Intergenic
1194111910 X:89844330-89844352 AAAAAAAAAAATTTTAGTCCTGG - Intergenic
1194162341 X:90469172-90469194 ATAAAATAAAATTTTTGGCCAGG - Intergenic
1194417822 X:93635505-93635527 AAAAAACCCAATGTTCCACCTGG + Intergenic
1194901391 X:99515784-99515806 AAAAAAAAGAATTTTCAACCCGG + Intergenic
1195052265 X:101107910-101107932 AAAAAATACAAAATTAGGCCAGG - Intronic
1195554004 X:106200751-106200773 AAGAAACAGAATTGCCGGCCGGG + Intronic
1195621453 X:106959833-106959855 AAAAAGCACAATTTAAAGCCAGG - Intronic
1195873686 X:109515166-109515188 AAAAAAAAAAATTCTTGGCCAGG + Intergenic
1196202453 X:112900720-112900742 AAAAAAAACTATTGTAGGCCGGG - Intergenic
1196265261 X:113636485-113636507 AAAAAACACAATGAGTGGCCAGG + Intergenic
1196327527 X:114425284-114425306 AAAAAAAAAAATTGTGGGCCGGG + Intergenic
1196430877 X:115623932-115623954 AAAATGCACACTTGTCGGCCGGG + Intronic
1196476952 X:116098272-116098294 AAAACAAACAATTATTGGCCAGG - Intergenic
1196907418 X:120451441-120451463 AAAAAAAACTAATTTAGGCCAGG - Intronic
1196969417 X:121092468-121092490 AAAAAAAACAATTCTTGGCAGGG - Intergenic
1197090038 X:122524978-122525000 AAAAAACATATTTTTCAGACAGG - Intergenic
1197240959 X:124122887-124122909 AAAAAAAGCAATTCTCGGCCAGG + Intronic
1197381452 X:125747276-125747298 AAAAAACACAATAATTGGCCGGG - Intergenic
1197755555 X:129991635-129991657 AAAAAAGAATATTTTCTGCCGGG - Intronic
1198150385 X:133902947-133902969 TAAAAACACCATTTTAGGCCGGG + Intronic
1198254435 X:134912941-134912963 AAAAAAAAAAAATTTTGGCCAGG + Intronic
1198863722 X:141097787-141097809 TAAAAATACAAATTTTGGCCGGG - Intergenic
1198898966 X:141489590-141489612 TAAAAATACAAATTTTGGCCGGG + Intergenic
1198945942 X:142014120-142014142 TAAAAAAGCAATTTTTGGCCGGG + Intergenic
1198987626 X:142474146-142474168 AGAAACCACATTTTTCTGCCAGG - Intergenic
1199111866 X:143945225-143945247 AATAAAATCAATTTCCGGCCAGG + Intergenic
1199244807 X:145590847-145590869 AAAAAAAAAAATGCTCGGCCGGG - Intergenic
1200508621 Y:4046909-4046931 ATAAAATAAAATTTTTGGCCAGG - Intergenic
1200729530 Y:6719218-6719240 AAAAGGCACATTTTTGGGCCAGG - Intergenic
1200947458 Y:8859987-8860009 TAAAAACAGACTTTTTGGCCAGG + Intergenic
1201322397 Y:12714599-12714621 AAAAAACACAAAAATCAGCCAGG - Intronic
1201513121 Y:14787319-14787341 AAGATACACAATTTAAGGCCAGG - Intronic
1201543367 Y:15133351-15133373 ATAGAAAATAATTTTCGGCCAGG + Intergenic
1202301651 Y:23421786-23421808 AAAAAACACCCTTTTCTGGCTGG - Intergenic
1202569160 Y:26248812-26248834 AAAAAACACCCTTTTCTGGCTGG + Intergenic