ID: 1109295733

View in Genome Browser
Species Human (GRCh38)
Location 13:60528219-60528241
Sequence AAGGAGTAAGATAATGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 408}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109295731_1109295733 -9 Left 1109295731 13:60528205-60528227 CCAAGGAAGCAAAGAAGGAGTAA 0: 1
1: 0
2: 3
3: 53
4: 396
Right 1109295733 13:60528219-60528241 AAGGAGTAAGATAATGAGGTAGG 0: 1
1: 0
2: 1
3: 25
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109295733 Original CRISPR AAGGAGTAAGATAATGAGGT AGG Intronic
901379167 1:8861436-8861458 AAGGAGAAAGGTAAAGAGATGGG + Intronic
902318637 1:15643559-15643581 AAGGTGTAACATAATGAGACTGG + Exonic
903286185 1:22278198-22278220 AAGGAGCAAGAGAAAGAGGATGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
907117175 1:51979134-51979156 ATGGAGGAAGAAAGTGAGGTTGG + Intronic
907434195 1:54433700-54433722 AAGAACTAAGATAAGGGGGTGGG + Intergenic
907720764 1:56970007-56970029 AAGGAGACAGATAATTATGTTGG - Intergenic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
908756278 1:67471718-67471740 AAGGAGTAAGAGAGGAAGGTGGG - Intergenic
908807930 1:67949783-67949805 AAGAAGTATGATAGTGATGTAGG + Intergenic
908896233 1:68903429-68903451 AAGAAGTAACATCATGGGGTAGG + Intergenic
909600883 1:77459786-77459808 AAGGAGTTAGAAAAGGAAGTGGG + Intronic
909946416 1:81668943-81668965 TAGGAGCAAGATATTGAGGAAGG - Intronic
910174495 1:84414494-84414516 GAGGAGAAAGATAGTGAGGTTGG - Intronic
910180641 1:84479075-84479097 AAAGAGTGAGATGATGAGTTTGG - Intergenic
911659219 1:100481320-100481342 AAGGATAAAGATAAAGAGTTCGG + Intronic
912030973 1:105243225-105243247 AAAGAGTAAAATAAAGATGTAGG + Intergenic
912687253 1:111777293-111777315 AAGAAGTAGGAAAAGGAGGTAGG + Intronic
912788724 1:112629942-112629964 AAGGAGTTGGATATTGAGCTGGG - Intronic
913049575 1:115105286-115105308 CAGGCAAAAGATAATGAGGTGGG - Intergenic
913483731 1:119315082-119315104 AAGGAGTAAGATCCTGTGTTAGG + Intergenic
915156592 1:153881746-153881768 AAGGAGGAAAATAATGAGATGGG + Intronic
915494416 1:156271336-156271358 AAGAAGTTATATAATGAGCTTGG - Intronic
915702285 1:157807304-157807326 CAGGGGTAAGATAAGGAGGGAGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916164367 1:161952243-161952265 AAGCAGTAAGAAACTGGGGTGGG - Intronic
916892228 1:169123035-169123057 AAGTGGTTACATAATGAGGTGGG - Intronic
917015337 1:170525119-170525141 AAGGAGTCAGAAAATGAGTAAGG + Intergenic
917039342 1:170786867-170786889 ATGGATAAAGATAATGGGGTTGG + Intergenic
917581346 1:176381214-176381236 AAGGAGTAAGATAGTGAATATGG - Intergenic
918564662 1:185914585-185914607 ATGGGGTAAGAGAATGTGGTGGG - Intronic
919223239 1:194659228-194659250 AAGGATTAAAAAAATGAGATAGG - Intergenic
920761908 1:208792243-208792265 AAGCAGTATGATAATGACATGGG - Intergenic
921325938 1:213986339-213986361 AAGGAGAAAAAAAATTAGGTCGG - Intronic
921510824 1:216026875-216026897 ATTGAGTACGATAATGAGGCAGG - Intronic
921577405 1:216852801-216852823 AAGAAGTAAGAAGATAAGGTAGG - Intronic
921757608 1:218878464-218878486 AAGGAGTAATATAATCAACTTGG - Intergenic
921769264 1:219015913-219015935 AAGGAGTAAAAGAATGTGTTAGG + Intergenic
922280554 1:224119365-224119387 AAGCAGGCAGATCATGAGGTCGG - Intronic
923230521 1:231982336-231982358 AAGGAGAAAGGTAAGGAGGAAGG - Intronic
923614297 1:235524140-235524162 AACGAGTTAGTCAATGAGGTGGG - Intergenic
923863215 1:237913432-237913454 AAGGAGGAAGCTGATGAGGAGGG + Intergenic
924165959 1:241283715-241283737 AAGGAGGAAAATAAAGAGGTTGG - Intronic
1064094599 10:12413868-12413890 AATGAGAAAGATAATGCAGTGGG + Intronic
1064564469 10:16625790-16625812 AAGGAGTAGGAGCAAGAGGTTGG + Intronic
1064707064 10:18084091-18084113 AAGAAGTGAGAGAATGAGGAAGG - Intergenic
1065193692 10:23239875-23239897 AAGCATTATGTTAATGAGGTAGG + Intergenic
1065451532 10:25863628-25863650 GGGGAGTATAATAATGAGGTTGG + Intergenic
1066258526 10:33705572-33705594 AAGAATTAAGATAATGGAGTTGG + Intergenic
1066492929 10:35911887-35911909 ATAGAATAAGATACTGAGGTAGG + Intergenic
1067151564 10:43739156-43739178 AAGGAGTGAGATACTGAGTTTGG + Intergenic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1068638120 10:59370074-59370096 AAAGAGTATGATAAAGAGGATGG - Intergenic
1069817976 10:71210556-71210578 AAGGAGAGAGAGAAAGAGGTTGG + Intergenic
1071458742 10:85871623-85871645 AAAAAGGAAGCTAATGAGGTTGG + Intronic
1071473576 10:86005406-86005428 AAGGAGAAAGATCATGAGCAAGG + Intronic
1071713025 10:88068227-88068249 AAGTAGTAAGTGGATGAGGTAGG + Intergenic
1071932367 10:90486761-90486783 AAGGGGTCAGATAATGATGGGGG - Intergenic
1072297674 10:94027115-94027137 AAGTAGTTAGATAAACAGGTGGG - Intronic
1072332346 10:94365987-94366009 AAGGAGGAAGAAATGGAGGTAGG - Intergenic
1074100566 10:110351564-110351586 AAGTAATAAGATACTGTGGTAGG + Intergenic
1074423130 10:113326978-113327000 AATCAGTAAGATAATGTGCTTGG + Intergenic
1074601082 10:114913957-114913979 AAGCAGTGAGATATTTAGGTAGG + Intergenic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1076197899 10:128533251-128533273 AAGAAGGAAGAAAATGAGGGAGG + Intergenic
1076937144 10:133573725-133573747 ATGGAAGAAGATAATGAGGTAGG + Intergenic
1077934646 11:6770757-6770779 AAGGAGGAACATAATTAGCTGGG + Intergenic
1078861655 11:15253571-15253593 AAGGAGGAAGAAAAGGAAGTTGG + Intergenic
1079252785 11:18799290-18799312 AATGAGGCAGATACTGAGGTAGG + Intergenic
1079740775 11:24057163-24057185 AAGAATAAAGAAAATGAGGTAGG + Intergenic
1081253257 11:40861540-40861562 AAGGAGTAAGATCAGGAGTGTGG + Intronic
1081403454 11:42668864-42668886 AAGGAGGAAGAGAGTGAGGGAGG + Intergenic
1082240557 11:49865559-49865581 AGAGAGTAAGTGAATGAGGTGGG + Intergenic
1082803165 11:57429167-57429189 AAGGTGTGAGATGATGAGGAAGG - Intergenic
1085232718 11:74986972-74986994 AGGGAGTGCCATAATGAGGTGGG + Intergenic
1086231133 11:84571211-84571233 AAAGAGGAAGAAAAGGAGGTAGG - Intronic
1086307089 11:85493289-85493311 AATGAGCAAGATAGTGTGGTTGG - Intronic
1086322851 11:85668625-85668647 CAGGAATAAGATAAGGAAGTTGG - Intronic
1086520697 11:87664970-87664992 AAGCAGGCAGATCATGAGGTCGG + Intergenic
1087365399 11:97212403-97212425 AAGGATCAGGATAATGATGTGGG - Intergenic
1089106989 11:116018678-116018700 CAGGAGCAAGAGAGTGAGGTGGG + Intergenic
1089196377 11:116696110-116696132 AAGGAGGGAGATAAGGAGGGAGG - Intergenic
1089276775 11:117342042-117342064 AAGAAGGAAGTAAATGAGGTAGG - Intronic
1089923241 11:122230299-122230321 TAGGAATAAGCCAATGAGGTGGG - Intergenic
1090309533 11:125722804-125722826 AGGGAGGGAGATAATGAGGCAGG - Intergenic
1091105832 11:132919094-132919116 AAGTAGATAGATAATGAGTTGGG + Intronic
1091971398 12:4789923-4789945 AAAGAGTAAAATAATGAGCCGGG + Intronic
1093860808 12:24164733-24164755 AAGCAATAATATATTGAGGTAGG - Intergenic
1094005569 12:25746438-25746460 AAGGAGAAAGATGATTAGCTGGG + Intergenic
1094161208 12:27392935-27392957 AAAGAGCAAGATGATGGGGTAGG - Intronic
1094270188 12:28605563-28605585 GAACAGTTAGATAATGAGGTTGG - Intergenic
1095408509 12:41894823-41894845 AAGGAATAATATTAAGAGGTGGG - Intergenic
1095871697 12:47035295-47035317 CTGGAGTAAGATGATGAGGGAGG + Intergenic
1096419251 12:51442229-51442251 ATGGAGCAAGATATTGAGGTTGG - Intronic
1096454624 12:51774725-51774747 AAGGGGTGAGAGAATGAGATGGG + Intronic
1097278822 12:57831816-57831838 GAGGAGGAAGACAATGTGGTAGG + Intronic
1098445633 12:70563119-70563141 GAGGAGCAAGAGAATGAGGGAGG + Intronic
1098911644 12:76215107-76215129 CAGAAGCAAGATAATGAGGGGGG + Intergenic
1098957730 12:76704880-76704902 AATGAGTAAGAGAAGGGGGTGGG - Intergenic
1100432566 12:94543659-94543681 AAGGAGCAAGAGAGAGAGGTGGG - Intergenic
1100581712 12:95945518-95945540 AAACATTCAGATAATGAGGTGGG - Intronic
1101119625 12:101565452-101565474 AGGGAGTTACAAAATGAGGTTGG - Intergenic
1101291955 12:103379290-103379312 AGGGAGGCAGATAATGAGATGGG - Intronic
1101541627 12:105670780-105670802 ATGGAGTATGAGAAGGAGGTAGG - Intergenic
1101925652 12:108969335-108969357 AAGGAGAAAGAGAGCGAGGTAGG - Intronic
1102661323 12:114531372-114531394 AAGAAGGAAGAAAATGAGGGTGG + Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1102913679 12:116737582-116737604 AAGGAGGAAGATAAGGAAGGAGG + Intronic
1103219497 12:119231993-119232015 AAGGAGGAAGATGAGGAGGATGG - Intergenic
1104212360 12:126701449-126701471 AAGGAGTTAGAAAATGATGATGG + Intergenic
1104363249 12:128153547-128153569 GATCAGGAAGATAATGAGGTTGG + Intergenic
1105965869 13:25384135-25384157 TAGGAGTAAGATAATAAAGCAGG - Intronic
1107782882 13:43923802-43923824 AGGGGGAAAGATAATGAGGGAGG - Intergenic
1107790511 13:43997709-43997731 AAGTGGTGAGATAATTAGGTAGG - Intergenic
1108166907 13:47702758-47702780 AAGGATTATAATAATCAGGTGGG + Intergenic
1108633105 13:52305856-52305878 AAAGAGGGAGATAATGAGATTGG - Intergenic
1108653586 13:52506704-52506726 AAAGAGGGAGATAATGAGATTGG + Intergenic
1108698944 13:52927307-52927329 AAGGAGGAAGAAAAGGAGGAAGG - Intergenic
1109295733 13:60528219-60528241 AAGGAGTAAGATAATGAGGTAGG + Intronic
1112054936 13:95681815-95681837 AAGGTCTAAAAGAATGAGGTAGG - Intronic
1113206961 13:107927857-107927879 AACTAGTAAGAAAATGAGGCTGG - Intergenic
1113412667 13:110104202-110104224 AAGTATTAAGATAATAAGGTAGG - Intergenic
1113441801 13:110334956-110334978 GAGGAGGAAGATAAAGAGCTGGG + Intronic
1114654307 14:24306946-24306968 AAGGAGTAAGAGGATAATGTAGG - Exonic
1116109744 14:40562607-40562629 AAGTGGTGTGATAATGAGGTAGG - Intergenic
1116357883 14:43953937-43953959 CAGGTCTAAGATAATGAGTTTGG - Intergenic
1117132768 14:52702701-52702723 AAGCAGTGAGATGTTGAGGTAGG - Intergenic
1117390094 14:55254626-55254648 AAGGCTTATGATAATGAGCTGGG + Intergenic
1119001840 14:70889354-70889376 CAGGAGTAAAATAAGAAGGTTGG + Intergenic
1119328864 14:73779031-73779053 AAGGAGGAAGTTAGGGAGGTAGG + Intronic
1119358013 14:74023127-74023149 CAGGAGAAAGATAATATGGTAGG + Exonic
1119606693 14:76024629-76024651 AAGGAGTAAAGTAATAAGGCAGG + Intronic
1120725740 14:87938323-87938345 AAGGAGTTAGAGAGTGAGATGGG + Intronic
1122597598 14:102903969-102903991 AAGCAGGCAGAGAATGAGGTTGG + Intronic
1124102182 15:26705894-26705916 AAGGAGGGAGATAAGGAGGCAGG + Intronic
1124844091 15:33273935-33273957 GAGGAGGTAGATAAAGAGGTAGG - Intergenic
1124957876 15:34371263-34371285 AAGGAGGAGGAGAAGGAGGTGGG - Intergenic
1125150198 15:36522213-36522235 AAGGAGGAAGAGAGAGAGGTGGG + Intergenic
1125547278 15:40515290-40515312 AAGGAGGAAGAAAAGGAGGGTGG - Intergenic
1126881738 15:53106221-53106243 AATGAGTAAGATTCTGGGGTTGG + Intergenic
1127196485 15:56591468-56591490 CAGGAGGAAGAGAGTGAGGTGGG + Intergenic
1128337048 15:66793637-66793659 AAGGAGTAAGATGATTGGGGTGG + Intergenic
1129314438 15:74732688-74732710 GAGGAGGAAGAGAATGAGGCAGG - Intergenic
1129637281 15:77333841-77333863 AAGGAGTAGCATTATGAAGTTGG - Intronic
1129932257 15:79421680-79421702 ATGGAGTAAGTGAATGAGGGAGG + Intronic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1131231057 15:90659884-90659906 AAAGAGGAACATAATGAGATTGG + Intergenic
1132188323 15:99824786-99824808 AGAGATTAAGAAAATGAGGTAGG + Intergenic
1133568783 16:7021245-7021267 AAGTAGTAACCAAATGAGGTGGG - Intronic
1134760226 16:16707938-16707960 AAGGACTGTGATAATTAGGTGGG + Intergenic
1134985846 16:18651267-18651289 AAGGACTGTGATAATTAGGTGGG - Intergenic
1135671501 16:24379561-24379583 AAGGATAAAGATACTGAGGCTGG - Intergenic
1137925465 16:52536490-52536512 GAGTGGTAAGAAAATGAGGTAGG + Intronic
1138028482 16:53540538-53540560 AAGGAGAAAGAGAATGAAGGTGG + Intergenic
1138320556 16:56107608-56107630 ATGGAGTAAGGAAATGAGATTGG + Intergenic
1141122129 16:81367798-81367820 AAGGAGCAAGAAGCTGAGGTGGG + Intronic
1141840448 16:86570988-86571010 GAGGAGGAAGTTAAGGAGGTAGG + Intergenic
1141861179 16:86717671-86717693 AAGGAGAAAGATACTAAGGGAGG + Intergenic
1141862528 16:86727729-86727751 AAGGAGAAAGAAAATATGGTCGG + Intergenic
1143662431 17:8334218-8334240 AAGGTGTAAGAAACTGAGATAGG + Intergenic
1146174984 17:30660175-30660197 AAGGAGCAAGAGAAAGAGGAGGG - Intergenic
1146241690 17:31234782-31234804 AAGGATTACAATAATGTGGTAGG - Intronic
1146410055 17:32575542-32575564 TAGGACTAAGATAATAAGGTGGG - Intronic
1147354290 17:39881390-39881412 AATGAGAAAGAGAAAGAGGTGGG + Intergenic
1147460069 17:40562696-40562718 AAGGAGGAAGATGAGGAGGAAGG - Intronic
1147591590 17:41687351-41687373 AAATAATAAGATAATGAGGCTGG - Intergenic
1149329560 17:55567279-55567301 AAGGGGTGAGATGATGAGGGAGG + Intergenic
1149404014 17:56328723-56328745 AAGGGAAAAGATAATGAGTTTGG - Intronic
1150907941 17:69358676-69358698 AAGGAGAAAAATAATTAAGTTGG + Intergenic
1152991457 18:367190-367212 AAGGACTAATATAATGACGAGGG + Intronic
1153005050 18:490530-490552 AAAGAGTCAGATAATGTCGTAGG - Intronic
1153369916 18:4303642-4303664 AAGGATTGAGATGATGAGTTAGG - Intronic
1153850957 18:9093838-9093860 AAGGAGAAAGAAAGAGAGGTGGG - Intergenic
1155318451 18:24595139-24595161 AAGGAAGAAAATAATGAGTTGGG + Intergenic
1156340150 18:36203346-36203368 AGAGAGCAAGAGAATGAGGTGGG + Intronic
1156449291 18:37257867-37257889 AAGGAGAAGGATGAGGAGGTCGG + Intronic
1156902624 18:42319299-42319321 AAGGAGTGAGAGAATCATGTAGG - Intergenic
1157914254 18:51649165-51649187 AAGGTGTTTGATAATGAGCTAGG + Intergenic
1158778337 18:60615014-60615036 AATGAGCAAGAGAATGAGGAGGG + Intergenic
1159116191 18:64115423-64115445 AAGAAGGAGGAAAATGAGGTAGG + Intergenic
1159122747 18:64189945-64189967 AAGGAGAAAAATTATGAGGGGGG - Intergenic
1159664709 18:71144165-71144187 TAGAAGTAAGAGAATGAGGAAGG - Intergenic
1159863435 18:73675933-73675955 TAGGTGTTAGATAATGAGGAAGG - Intergenic
1159926502 18:74274500-74274522 AAGGAGAAAGAAAATGCTGTGGG + Intronic
1161764956 19:6202275-6202297 AAGGAGTAAACTGTTGAGGTGGG + Intergenic
1162554088 19:11375661-11375683 TAGAAGTAAGGCAATGAGGTAGG - Exonic
1162735199 19:12743169-12743191 GAGGAGGAAGATAAAGAGGGAGG + Intronic
1164801062 19:31077123-31077145 AAGTATAAAAATAATGAGGTGGG - Intergenic
1164945529 19:32290076-32290098 AAAAAGTAAAAAAATGAGGTGGG + Intergenic
1164972248 19:32542560-32542582 GAGGAGAAAGAGAATGAAGTAGG + Intergenic
1165572127 19:36784348-36784370 CAGGAGTATGATAATGAGCACGG + Intergenic
1166692761 19:44833578-44833600 AAGGAGGAAGAAAAGGAGGAAGG + Intergenic
1168473385 19:56659249-56659271 AGGGAGCAAGATAAGGAGGAGGG - Intergenic
925503967 2:4539744-4539766 AAGGAGTAAGATGAGGATTTGGG - Intergenic
925546116 2:5018460-5018482 AAGGTCTAAGAATATGAGGTGGG - Intergenic
925985858 2:9214150-9214172 AAGGCGTAAGCAAAGGAGGTAGG - Intronic
926074065 2:9926368-9926390 AAAGAGAGAGATAAAGAGGTGGG - Intronic
928704584 2:33934056-33934078 AACTAGTAAAATAATGGGGTGGG - Intergenic
929137518 2:38638803-38638825 AAGAAGGAAGAAAAGGAGGTAGG + Intergenic
930225843 2:48792107-48792129 AAGGAGAAAGATAGGCAGGTGGG - Intergenic
930793069 2:55355443-55355465 AATGAGAAAAATAAGGAGGTTGG - Intronic
931900337 2:66781393-66781415 AAGGAGCAAGTTAAGGAGGGAGG + Intergenic
935357013 2:102210738-102210760 TAGGAGTGAGATCATGAGTTTGG + Intronic
937600642 2:123727341-123727363 GAGGAGGAAGAAAATGAGATTGG + Intergenic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938113539 2:128587875-128587897 AAGAAGGAAGAGAAAGAGGTGGG + Intergenic
938635152 2:133216828-133216850 GAGGAGTAAGATGCAGAGGTAGG + Intronic
939876055 2:147579382-147579404 AAAGAGTAAGAGAATGGGATAGG - Intergenic
942712182 2:178849049-178849071 AAGGATAAAGATAATTTGGTTGG + Intronic
943750504 2:191504832-191504854 AAAGAGTAAGATAATGTTGTAGG - Intergenic
943822676 2:192347067-192347089 AAAGATTAAGAAAAAGAGGTTGG - Intergenic
943961465 2:194269679-194269701 AAGTACTAGGATAATGGGGTTGG + Intergenic
944322598 2:198365474-198365496 AAGGAGAAAAATTATGAAGTAGG + Intronic
944335213 2:198525707-198525729 GAGGAGTGAAACAATGAGGTTGG - Intronic
944393858 2:199247549-199247571 AAGGAGAAAGTGATTGAGGTTGG - Intergenic
945142842 2:206705479-206705501 TAGGAAGAAGATCATGAGGTTGG + Intronic
945202134 2:207292862-207292884 AAGGACTAATACCATGAGGTAGG - Intergenic
945372079 2:209031360-209031382 AAGGAATAAAACAATGAGGCTGG + Intergenic
945921350 2:215757900-215757922 AAGGAGCAAGAGAAAGAGATGGG - Intergenic
946757056 2:222958366-222958388 AAGGAGTGAGAAAATGGGATAGG - Intergenic
946807076 2:223481531-223481553 ACGGACTAACATAATTAGGTCGG + Intergenic
947351249 2:229247934-229247956 GAGTAGTAAGAGAAGGAGGTGGG - Intronic
948173504 2:235925345-235925367 AAGGAGTAAGATATGAAGCTGGG - Intronic
948209595 2:236183052-236183074 AAGGAGGAAGACAAGGAGGAGGG - Intergenic
948428530 2:237903482-237903504 AAGGTGTAGGATACTGAGGCAGG - Intronic
948823905 2:240565228-240565250 AATGAGTAAAATACTGTGGTTGG + Intronic
1169596595 20:7206819-7206841 AAGGAGAAAGTTCATGAGTTTGG + Intergenic
1170980452 20:21207429-21207451 AAGGAGGAAGATGAGGAGGAGGG - Intronic
1171052861 20:21876792-21876814 AAGGTGTAAGATAATGAGAGTGG + Intergenic
1172044076 20:32067000-32067022 GAGCAGCAAGATAATGAGTTGGG - Intronic
1173698835 20:45048397-45048419 AAAGGGAAAGATACTGAGGTGGG + Intronic
1174260501 20:49291322-49291344 AAGTGCTAAGATACTGAGGTTGG - Intergenic
1174441845 20:50561922-50561944 AGGGAGAAAAATGATGAGGTTGG - Intronic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175534075 20:59695356-59695378 AAGGAGGAAGAGAATGAAGCAGG - Intronic
1178465720 21:32845984-32846006 AAGGAGTGTAATGATGAGGTTGG - Intergenic
1178596215 21:33955446-33955468 AAGAAGATAGATAATGGGGTCGG + Intergenic
1179262086 21:39766200-39766222 AAGGAGAAAGAGAATGAAGCAGG - Intronic
1179388305 21:40963141-40963163 AAGGAGGAAGAGACTGAGGAAGG + Intergenic
1179620594 21:42613303-42613325 CAGGAGGAAGAGAATGAAGTTGG + Intergenic
1182057594 22:27372148-27372170 AAGGAGTGAGAAAATGAAATAGG + Intergenic
1183929547 22:41228122-41228144 AAGAGGTAAGAGATTGAGGTTGG + Intronic
1184110339 22:42390408-42390430 AAGAAGGAAGATAGGGAGGTTGG + Intronic
1184420310 22:44378338-44378360 AGGGAGGAAGAGAAGGAGGTAGG - Intergenic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
950840465 3:15963835-15963857 TGACAGTAAGATAATGAGGTGGG + Intergenic
951825249 3:26860980-26861002 AAGCTGTAAGGTAATGAAGTAGG + Intergenic
952253109 3:31673296-31673318 AAGAAGTAAGATATAAAGGTAGG - Intronic
952620450 3:35333255-35333277 AAAGAGGAAGAGAAAGAGGTAGG - Intergenic
953965304 3:47300182-47300204 AAGGAGGAAAAGAAGGAGGTGGG - Intronic
954288858 3:49638402-49638424 ATGGAGGAAGAGACTGAGGTTGG + Intronic
956238668 3:67104657-67104679 CAGGAGCAGGATAATGAGTTTGG + Intergenic
956445629 3:69323042-69323064 AAGGAAAAAGACAATGAGGGAGG + Intronic
957199001 3:77107926-77107948 AAGAAGAAAGAAAATGAGGCAGG - Intronic
957559399 3:81802951-81802973 AAGGAGTAGGGGAATGAGTTGGG - Intergenic
957885371 3:86281353-86281375 AAGGAGAATGATAATGGAGTAGG - Intergenic
958716373 3:97787293-97787315 AAGGTATAAAGTAATGAGGTTGG + Intronic
958813177 3:98886490-98886512 AAGGAGAAAGTTAGTGAAGTTGG - Intronic
958894279 3:99812936-99812958 AGGGGGTAAAATGATGAGGTAGG - Intergenic
960183239 3:114607597-114607619 AAAGAGTAAGAGAATGAGGCTGG - Intronic
960299332 3:115983031-115983053 AAGGAGTGAGATATGGAAGTTGG - Intronic
960826344 3:121789098-121789120 GAGGGGTAAGATAATGACTTTGG + Intronic
961025593 3:123553258-123553280 AAAGGGCAAGATAATTAGGTTGG + Intronic
962912192 3:139863153-139863175 GTGGAGTGAGATAAAGAGGTTGG + Intergenic
964064912 3:152565391-152565413 AAGTAGTTATATAATGAGCTCGG - Intergenic
965908135 3:173736220-173736242 AAGGAGAAAGAAAAGAAGGTAGG - Intronic
966202995 3:177376965-177376987 AAGCAGTGAGATCATGAGGTAGG + Intergenic
966286849 3:178307422-178307444 AAGGCCTCAGATAATGAGCTAGG + Intergenic
966505315 3:180694236-180694258 TTGGAGTAAGATAATGATATGGG - Intronic
966544651 3:181132057-181132079 AAGGGAAAAGATAATGAGTTTGG + Intergenic
966582556 3:181584624-181584646 AAGAAGAAAGATAATGAAGATGG - Intergenic
967289410 3:187904542-187904564 AAGGAGTGAGATCATGAAGATGG - Intergenic
967427297 3:189341575-189341597 GAGGAACAAGATAATCAGGTGGG + Intergenic
968158494 3:196404182-196404204 AAGCAGGAAGATAATGAATTAGG - Intronic
970689942 4:18611506-18611528 AGGGAGGAAGAAAATGAGGGAGG + Intergenic
970807374 4:20052182-20052204 AATGAGTTAGAAAATGAGGGTGG - Intergenic
972653353 4:41041705-41041727 ATGGAGTAAGATAAAGAGCTAGG - Intronic
972966681 4:44518985-44519007 AAGGAAGAAGAGAATTAGGTTGG + Intergenic
973151960 4:46899112-46899134 GAGGAGAAGGATAATGAGTTGGG - Intronic
973185718 4:47325522-47325544 AATGAGGAAGATAATGAGGAAGG - Intronic
973700826 4:53535318-53535340 AAGGAGAAAGATAATGACTACGG - Intronic
974304968 4:60124402-60124424 AAGGAGGTAGAGAATGAGGTAGG + Intergenic
975560738 4:75706055-75706077 AAGGAGTGACACTATGAGGTTGG + Intronic
975705293 4:77105730-77105752 AAGGACTATGAAAATGAGGCTGG + Intergenic
976802789 4:89011146-89011168 AATTATTAAGATAATGAGGATGG - Intronic
977152783 4:93533962-93533984 AGCCAGAAAGATAATGAGGTGGG - Intronic
979034647 4:115699742-115699764 ATGGAGTAAGATAGAGAGGTTGG - Intergenic
979555922 4:122047505-122047527 AAGGAGCAAGAGAATGAGACAGG + Intergenic
980238760 4:130144925-130144947 AAGGAGTAGGATAATGGTTTGGG + Intergenic
980707017 4:136511464-136511486 AAGGATTAAGCTAGTGAGGAAGG - Intergenic
980716310 4:136634786-136634808 AATGAGTAAGAAAATAAAGTTGG - Intergenic
980875914 4:138661975-138661997 GAGGACTAGGAAAATGAGGTTGG - Intergenic
981080430 4:140634462-140634484 AAGGGGGAAGAGAATGTGGTGGG - Intronic
981761815 4:148202792-148202814 AAGGAGCAAGATACAGAGGAAGG - Intronic
982434625 4:155369680-155369702 AAGGACAAAGATGATGATGTTGG + Intronic
983732240 4:171010436-171010458 AGAGAGCAAGAGAATGAGGTGGG - Intergenic
984194198 4:176639050-176639072 TGGGAGTAAGAGAATGAGATAGG + Intergenic
984419111 4:179496850-179496872 AAGGAGAAAGAGGAGGAGGTGGG + Intergenic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
990023496 5:51158025-51158047 AACCAGGAAGACAATGAGGTAGG - Intergenic
991459194 5:66838994-66839016 AAGAAGTAAGATAAACAGCTAGG + Intronic
991562656 5:67970953-67970975 AAGGAGGAGGAGAAAGAGGTAGG + Intergenic
993026279 5:82650799-82650821 AAGGAGCAGGACAATGAAGTAGG - Intergenic
993548370 5:89242259-89242281 AAGCATGAAGATATTGAGGTAGG + Intergenic
995039929 5:107576202-107576224 AAAGAGTATGATAATGATGATGG - Intronic
995817343 5:116186071-116186093 AGGGAGAAAGATAATGAAGATGG - Intronic
995976101 5:118036551-118036573 AGGGAGGAAGAAAATGAGGGAGG + Intergenic
996215825 5:120864154-120864176 AAAGAGGAAGATAAAGAGGGAGG - Intergenic
996422926 5:123281783-123281805 AAAGAGTAAGATAATGTACTTGG - Intergenic
996613250 5:125409862-125409884 AATCAGTCAAATAATGAGGTGGG + Intergenic
996663251 5:126028056-126028078 AAGGAGGGAGATAATGAAGTTGG + Intergenic
997113205 5:131097859-131097881 AGGGAGAAAGATGATGTGGTAGG - Intergenic
998729464 5:145058075-145058097 GAGCAATAAGATAATGAGGCTGG + Intergenic
999084183 5:148872642-148872664 AAGGAGAAAGAGCATGAGATCGG + Intergenic
999090446 5:148931658-148931680 AAGGAGGAAGAGAAGGAGGGAGG - Intronic
999628460 5:153544767-153544789 AAGGATTCAGAAAATGACGTTGG + Intronic
1000024363 5:157346051-157346073 AAAGATGAAGATAAAGAGGTGGG - Intronic
1000395473 5:160770307-160770329 AAGGAGGCAGATGAAGAGGTGGG - Intronic
1000855359 5:166391275-166391297 ATGGAGTAAAATAATGAAGTGGG + Intergenic
1001394394 5:171405096-171405118 AAGGAATAAGATGATTAGCTAGG - Intronic
1002972372 6:2036980-2037002 GAGGCGAAAGGTAATGAGGTAGG + Intronic
1003280030 6:4683168-4683190 AAGGACTAATACAGTGAGGTAGG + Intergenic
1003389651 6:5702812-5702834 TAGGACTAAGAGAATGAGGAGGG + Intronic
1003548210 6:7079037-7079059 AAGGAGGAAGAGAAAGAGGAAGG + Intergenic
1003621158 6:7701653-7701675 AAGGAGGAAGAGAGTGAAGTGGG + Intergenic
1004813125 6:19281692-19281714 AAGGAGAAAAAAAATGGGGTGGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005451546 6:25977695-25977717 GAGGAGGAAGAGAAAGAGGTGGG + Intronic
1005478301 6:26230923-26230945 AAGGAATAAGAGAATTAGGTGGG - Intergenic
1005791565 6:29307877-29307899 AAGGAGAAAGACAATTAGTTTGG + Intergenic
1006137732 6:31906119-31906141 AAGGAGAAAGAGAAAGAAGTTGG - Intronic
1007554620 6:42755565-42755587 AAGGAGAGAGACAAAGAGGTGGG - Intronic
1007917979 6:45578714-45578736 AAGGAGAAAGAAAAAGAGATGGG - Intronic
1008442147 6:51543913-51543935 AAGGAGGAAGAGAAAGAGGAAGG - Intergenic
1008768905 6:54954542-54954564 AAGGAGTAAAATAAATAGATAGG + Intergenic
1009502154 6:64427800-64427822 AAGAAGTAACACAATGAAGTAGG + Intronic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1009984194 6:70763566-70763588 AAGGATTAAGCTAGTGAGGAAGG + Intronic
1010613281 6:77982855-77982877 AAGGAGTTTGATAATGACTTTGG + Intergenic
1011452316 6:87506891-87506913 ATGGAGTAGGATCATGAGGTGGG + Intronic
1011974531 6:93279398-93279420 AATTAGTAAGAAAAAGAGGTGGG - Intronic
1011997611 6:93613085-93613107 AAGCAGTAAAATTATGAGTTTGG + Intergenic
1012140294 6:95618485-95618507 AAGGGGTAAATTAATAAGGTAGG - Intergenic
1012261968 6:97097968-97097990 AAGGAGTAAGATGCTGTGTTTGG - Intronic
1012943151 6:105438497-105438519 AGGAAGGAAGATAATGAGGCTGG - Intergenic
1013378684 6:109544539-109544561 CAGGAGAAAGAGAGTGAGGTGGG - Intronic
1014241122 6:119018541-119018563 CAGGAATAAAATAATGAGATGGG + Intronic
1014572663 6:123029564-123029586 AAGGAATAAGGAAATAAGGTTGG + Intronic
1014989073 6:128051649-128051671 TAGGAGGAAGAAAGTGAGGTAGG - Intronic
1015402149 6:132798712-132798734 GTGGATTAAGATAATGAGGCGGG - Intergenic
1016173169 6:141044907-141044929 AAGGATAAAGAAAATGTGGTAGG - Intergenic
1016620335 6:146102127-146102149 AAAGAGTAAGAAAAAGAGGCAGG - Intronic
1016928310 6:149376605-149376627 AAGGACTGAGTTAATGAGGAAGG - Intronic
1017272813 6:152529144-152529166 AAGGAGAAAGATAATAAAATAGG - Intronic
1018155065 6:160977983-160978005 AAGCAGGCAGATCATGAGGTCGG - Intergenic
1018155390 6:160980740-160980762 CATGAGTAAGATACTGAAGTAGG - Intergenic
1018327837 6:162692911-162692933 AAGGAGTCAGATAATAAGGCTGG - Intronic
1018737620 6:166699682-166699704 AAGGAGTGAGCAAATGAGTTCGG + Intronic
1020179262 7:5908724-5908746 AAGGAGACAGACAATGAGGCTGG - Intronic
1020303672 7:6816131-6816153 AAGGAGACAGACAATGAGGCTGG + Intronic
1020794749 7:12665856-12665878 AAAGCCTAGGATAATGAGGTTGG - Intergenic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021739425 7:23671043-23671065 CAGGAGTAAGATAATGATTGTGG - Intergenic
1022323875 7:29312296-29312318 AGGGAGGGAGAGAATGAGGTAGG - Intronic
1024554090 7:50588551-50588573 AAGGAGAAAGACACTGGGGTTGG - Intergenic
1025006544 7:55360108-55360130 GAGGAGTAAGATAGTGAAGGGGG + Intergenic
1026138040 7:67680610-67680632 GAGGTGTTAGATCATGAGGTTGG - Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026574401 7:71560300-71560322 AAGGAGGAGGAGAATGAGATAGG - Intronic
1028207691 7:88035097-88035119 AAGGAGCAAGAGAATGAGGCAGG - Intronic
1028294189 7:89106899-89106921 AGGGAGTAAGATGATGAATTTGG + Intronic
1029846419 7:103416744-103416766 AAGGAGGAAGAAAATGAGAGAGG - Intronic
1029854000 7:103494926-103494948 ATGGAGTAAGATAAAGAGGAAGG + Intronic
1030781442 7:113605504-113605526 GAGGAGGAAGATAAGGAGTTTGG + Intergenic
1030917275 7:115330954-115330976 CAGGAGCAAGAGAAAGAGGTGGG + Intergenic
1031678748 7:124644879-124644901 AAGGGGGAAGATTAAGAGGTGGG - Intergenic
1035343337 7:158179663-158179685 AAGGTAAGAGATAATGAGGTAGG + Intronic
1036732082 8:11274777-11274799 AAGAAGTAGGATAACTAGGTGGG - Intergenic
1037006396 8:13786295-13786317 AAGGAGTAAGCTAGAGATGTTGG - Intergenic
1037483985 8:19330418-19330440 AAGAAGAAAGAGAATGAGATGGG - Intronic
1037772219 8:21809137-21809159 AAGGAGTAAGTGAATAAGCTAGG + Intronic
1038743406 8:30235232-30235254 AAGGAGTAAGACAAAGAGCATGG - Intergenic
1039304072 8:36242000-36242022 AAGGAATAAGATGAGGAGGTAGG + Intergenic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1041745213 8:61201217-61201239 AAGGAATAAGATAATCATGATGG + Intronic
1042689425 8:71481195-71481217 AAGTAGTAACATAATAAAGTTGG + Intronic
1042878446 8:73461694-73461716 TAGGAGGGAGAGAATGAGGTGGG + Intronic
1042917810 8:73892555-73892577 AAGGAGTGAGAAAGTGAGGATGG + Intergenic
1042940312 8:74100643-74100665 CAGGAGAAAGATAAGGAAGTGGG - Intergenic
1042959515 8:74288525-74288547 GAAGAGTAAGAAAATGGGGTTGG + Intronic
1043090192 8:75891666-75891688 AAGGAGCAAGAAAGAGAGGTGGG + Intergenic
1043310438 8:78852357-78852379 AAGGAGTAAAGTAATTAAGTAGG + Intergenic
1043447674 8:80335074-80335096 CAGGAATAAGATGAAGAGGTGGG - Intergenic
1043669286 8:82861690-82861712 GAGTTGTAAGATAATTAGGTGGG - Intergenic
1046799506 8:118409791-118409813 AACCAGTAAGATAATGAAGCTGG + Intronic
1047843873 8:128785009-128785031 CAGGAGGAAGAGAATGAAGTGGG + Intergenic
1047886174 8:129252486-129252508 AAGAAGGAAGAAGATGAGGTCGG - Intergenic
1048007638 8:130432027-130432049 AAGGAGGGGGAAAATGAGGTGGG + Intronic
1048557750 8:135497096-135497118 AAGGAGTAAGAGAGGGAAGTTGG + Intronic
1048691720 8:136972762-136972784 GAGAAGTAAGCTAAAGAGGTAGG - Intergenic
1049430114 8:142558734-142558756 AAGGCGGAAGACAGTGAGGTGGG - Intergenic
1050128393 9:2383473-2383495 CAGGAGCAAGAAAATGAGGGAGG + Intergenic
1051406035 9:16738734-16738756 AGGGAGTAAGAAATTGAGCTAGG - Intronic
1052204756 9:25826416-25826438 GAGGAGGTAGATAATGAGGTAGG - Intergenic
1053549764 9:39064096-39064118 AAGCAGTAAGAACTTGAGGTAGG - Intergenic
1053813876 9:41884193-41884215 AAGCAGTAAGAACTTGAGGTAGG - Intergenic
1054616720 9:67303247-67303269 AAGCAGTAAGAACTTGAGGTAGG + Intergenic
1056066296 9:82938936-82938958 AAGGAGTAGAAGAATGATGTAGG - Intergenic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1057339950 9:94191513-94191535 AAGGAGTGAGAGAGAGAGGTGGG + Intergenic
1059508551 9:114822371-114822393 AAAGAGTAGCATAAGGAGGTGGG + Intergenic
1060757073 9:126222096-126222118 AAGAAGAAAGCTAATGGGGTAGG + Intergenic
1185804516 X:3045146-3045168 AAAGAGAAAAATAAAGAGGTGGG + Intronic
1186607186 X:11104563-11104585 AAGGAGGAAGAAATTTAGGTTGG + Intergenic
1187196751 X:17093660-17093682 GAGGAGAAAGATAATGGGGGAGG - Intronic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1187649175 X:21381551-21381573 AAGAAGTGAGAGAATGAGATCGG - Intronic
1188159932 X:26786705-26786727 AAAGAGAAAGATTGTGAGGTAGG + Intergenic
1189565404 X:42236375-42236397 TAGGAGTAAGAGATGGAGGTAGG - Intergenic
1190557906 X:51655273-51655295 AAGTAGTAAGACAATGAGTAAGG - Intergenic
1193189903 X:78558136-78558158 AAGGAATGAGATAATGAAGCTGG - Intergenic
1194372351 X:93089828-93089850 AAGGAGTTAGAGAAAGAGATAGG - Intergenic
1194559065 X:95397690-95397712 AAGGAGCAAGAGAAAGAGGGGGG - Intergenic
1194588418 X:95766726-95766748 AAGGAGTAAGATATTGAGATGGG - Intergenic
1194618589 X:96139036-96139058 ATAGAGTAAGATAATCAGTTTGG + Intergenic
1195627834 X:107021992-107022014 ACAGAGTAAGATAGTGAAGTGGG - Intergenic
1198208665 X:134495004-134495026 AAGGAATAAGATTTTCAGGTAGG + Intronic
1198241977 X:134796389-134796411 AAGGAGGATGATGATGAGGAAGG + Intronic
1198805827 X:140493427-140493449 AAGTGGTAAGATCAAGAGGTAGG - Intergenic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1198985735 X:142450822-142450844 AACGAGGAAGATATTTAGGTTGG - Intergenic
1199239416 X:145528970-145528992 CAGGAGCAAGAGAGTGAGGTGGG - Intergenic
1199912833 X:152306549-152306571 ATGGAGTAAGTTAATATGGTGGG + Intronic
1200680398 Y:6203871-6203893 AAGGAGTTAGAGAAAGAGATGGG - Intergenic
1201532191 Y:15004070-15004092 AAGGAGTAAGTGGATGAGGGAGG - Intergenic