ID: 1109297542

View in Genome Browser
Species Human (GRCh38)
Location 13:60552861-60552883
Sequence TTTTAGCCATGGCTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 3, 1: 5, 2: 21, 3: 41, 4: 223}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109297530_1109297542 14 Left 1109297530 13:60552824-60552846 CCCTTTGAAGCCACAGCCCAAGT 0: 1
1: 12
2: 211
3: 413
4: 951
Right 1109297542 13:60552861-60552883 TTTTAGCCATGGCTGGAGCTGGG 0: 3
1: 5
2: 21
3: 41
4: 223
1109297535_1109297542 -3 Left 1109297535 13:60552841-60552863 CCAAGTTGCATCTTGGCCCCTTT 0: 1
1: 0
2: 63
3: 378
4: 910
Right 1109297542 13:60552861-60552883 TTTTAGCCATGGCTGGAGCTGGG 0: 3
1: 5
2: 21
3: 41
4: 223
1109297531_1109297542 13 Left 1109297531 13:60552825-60552847 CCTTTGAAGCCACAGCCCAAGTT 0: 1
1: 10
2: 232
3: 427
4: 914
Right 1109297542 13:60552861-60552883 TTTTAGCCATGGCTGGAGCTGGG 0: 3
1: 5
2: 21
3: 41
4: 223
1109297532_1109297542 4 Left 1109297532 13:60552834-60552856 CCACAGCCCAAGTTGCATCTTGG 0: 1
1: 1
2: 11
3: 100
4: 381
Right 1109297542 13:60552861-60552883 TTTTAGCCATGGCTGGAGCTGGG 0: 3
1: 5
2: 21
3: 41
4: 223
1109297534_1109297542 -2 Left 1109297534 13:60552840-60552862 CCCAAGTTGCATCTTGGCCCCTT 0: 1
1: 1
2: 42
3: 389
4: 1330
Right 1109297542 13:60552861-60552883 TTTTAGCCATGGCTGGAGCTGGG 0: 3
1: 5
2: 21
3: 41
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109297542 Original CRISPR TTTTAGCCATGGCTGGAGCT GGG Intronic
900960721 1:5917477-5917499 TGTTAGGCATGGCTGGATCCCGG - Intronic
901022792 1:6263452-6263474 TTTCAGCCATGGATGCAGGTGGG + Intergenic
902085789 1:13860999-13861021 TTGTCGCCCAGGCTGGAGCTCGG + Intergenic
902547322 1:17198277-17198299 TTGTAGTCCAGGCTGGAGCTCGG - Intergenic
902716484 1:18276309-18276331 TTCTAGCCATGCCTGCAGGTGGG - Intronic
903026965 1:20436210-20436232 TTTCAGGCATGGCTGGATCCAGG - Intergenic
903060967 1:20668360-20668382 TTTCAGGCACGGCTGGATCTAGG - Intronic
903298059 1:22358398-22358420 TTTCAGGCATGGCTGGATCCAGG - Intergenic
904187763 1:28719274-28719296 TTTTAGGAGTGGGTGGAGCTTGG - Intronic
904691915 1:32299532-32299554 TCTGAGCCTTGGCTGGATCTAGG + Intronic
905694293 1:39963377-39963399 TTGTAGCCACAGCTGGAGCCTGG - Intronic
905880791 1:41462503-41462525 TTTCAGTCATGGCTGCATCTGGG + Intergenic
906117554 1:43366593-43366615 TTTGGGCCAGGGCTGGGGCTGGG - Intronic
906325700 1:44843926-44843948 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
906950036 1:50326986-50327008 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
907039948 1:51250603-51250625 TTGTAGCCACAGCTGGAGCCTGG + Intronic
907315397 1:53567705-53567727 TTTTAGCCACAGCTGGGGCTAGG - Intronic
911369840 1:96983573-96983595 TTTAAGCAATGGCTGATGCTTGG + Intergenic
911473159 1:98343103-98343125 TCTTAGCCATCTCTGGAACTTGG - Intergenic
912712884 1:111962072-111962094 TCTTAGCCATCACTGGGGCTTGG - Intronic
915621511 1:157088591-157088613 ATTTTGCCATGAATGGAGCTTGG - Intergenic
916054856 1:161061628-161061650 TTTGAGTCATGGCTCTAGCTGGG - Intronic
916102801 1:161407060-161407082 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
919548214 1:198949778-198949800 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
919800420 1:201350807-201350829 GTTTAGCAAAGGCTGGATCTAGG + Intergenic
920297997 1:204971093-204971115 TTTGAGTGATGGCTGGGGCTGGG + Intronic
922881466 1:228984590-228984612 TTTTAGCCATGGTTTCACCTTGG + Intergenic
923547051 1:234930625-234930647 TGTTTCCCATGGTTGGAGCTGGG + Intergenic
924050793 1:240078115-240078137 TTTCAGCCGTGGCTGGAGCAGGG - Intronic
1062957781 10:1551751-1551773 ATTTGGCCATCGCTGGACCTGGG - Intronic
1063718348 10:8553071-8553093 CTTTTGCCATGACTGAAGCTGGG - Intergenic
1067522796 10:47020805-47020827 TTTAAGCCGTGGCTGGAGCGTGG - Intergenic
1068160216 10:53253563-53253585 CTTTAGCCATGGCTGGTGTTAGG - Intergenic
1068548910 10:58384999-58385021 TTCAAGCCAGGGCTGGAGCTCGG - Intergenic
1068580195 10:58730776-58730798 TTTGAGTCAGGGCTGCAGCTGGG + Intronic
1069805010 10:71116736-71116758 TTTGAGCTATGGCTGGAGCTGGG - Intergenic
1071977529 10:90969861-90969883 CTTCAGCCATGGCTGGATCTGGG - Intergenic
1072296037 10:94010243-94010265 TTTGAGCCACAGCTGGAACTGGG + Intronic
1073474696 10:103745258-103745280 TTTCAGGCATAGCTGGATCTAGG - Intronic
1073807244 10:107110725-107110747 TTTAAGCCATGGCTGGGGTCAGG + Intronic
1074539777 10:114354807-114354829 CTTCAGGCATGGCTGGACCTAGG - Intronic
1077233145 11:1467664-1467686 AGTGAGCCATGGCTGCAGCTGGG + Intergenic
1081130614 11:39374549-39374571 TATTAACCCTGCCTGGAGCTAGG + Intergenic
1083348617 11:62011756-62011778 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1084509473 11:69594282-69594304 TTTCAGGGATGGCTGGATCTAGG - Intergenic
1085215546 11:74827276-74827298 TTTTAGCCACGGCTGGGGTGTGG + Intronic
1085477706 11:76798358-76798380 TCATGGCTATGGCTGGAGCTGGG - Intergenic
1085965032 11:81513165-81513187 TTTTAGCCACAGCTGAAGCAGGG - Intergenic
1086954836 11:92925332-92925354 TTTTAGCCATAACTGGAGCTAGG - Intergenic
1088408610 11:109508538-109508560 CTTCAGCCATGGCTGGATCTAGG - Intergenic
1089624558 11:119742922-119742944 TTTGAGCCTTTGCTGGAGGTGGG + Intergenic
1089737723 11:120561553-120561575 CTTTTGCCATTGCTGGAGCGGGG - Intronic
1089989225 11:122842858-122842880 TGTTAGACATGGGTGGAGCATGG + Intronic
1096321382 12:50617003-50617025 TGTTGGCTATGGCTGGAGATGGG - Intronic
1098614636 12:72507910-72507932 TTTTAGCCACTGCTGGAGCTAGG - Intronic
1101082075 12:101196951-101196973 TTTTAGCCTTGGCTGCATATTGG - Intronic
1101524001 12:105510974-105510996 CTTTAGTCATGGCTGGATCCAGG + Intergenic
1101526414 12:105535179-105535201 TTTTAGCCATAGCTGGACACAGG + Intergenic
1102027035 12:109719545-109719567 TTCTAGACAGGGCTGGAGCAGGG + Intronic
1102194033 12:111011736-111011758 TTTCAGGCATGGCTGGATCCAGG + Intergenic
1102251907 12:111393287-111393309 TTTCAGGTATGGCTGGATCTAGG + Intergenic
1103275649 12:119709546-119709568 TTTCAGGCATGGCTGGATCCGGG - Intronic
1103957852 12:124588435-124588457 TTTCAGGCATGGCTGGATCCAGG - Intergenic
1104187871 12:126449707-126449729 TGTTTGTTATGGCTGGAGCTGGG - Intergenic
1104360118 12:128125083-128125105 TTTTTGCCATTCCTGGATCTTGG - Intergenic
1104433880 12:128740176-128740198 TCTGAGCCAGGGCTTGAGCTGGG - Intergenic
1104743707 12:131196790-131196812 CTTCAGGCATGGCTGGATCTAGG + Intergenic
1108512581 13:51169665-51169687 TTTTAGCCATGGCTGGAGCTGGG - Intergenic
1108583071 13:51843975-51843997 TAATAGTCATGGCTGGAGCAGGG + Intergenic
1108724333 13:53163746-53163768 TTTCAGCCATGGCTGGAGTCAGG + Intergenic
1108770950 13:53699947-53699969 TTTTAGCCATGGCTGGAGCTGGG - Intergenic
1109297542 13:60552861-60552883 TTTTAGCCATGGCTGGAGCTGGG + Intronic
1110603880 13:77408909-77408931 ATTTAGCAAGTGCTGGAGCTGGG + Intergenic
1111051210 13:82884675-82884697 TTTGTGCCACAGCTGGAGCTGGG + Intergenic
1111227134 13:85288751-85288773 TTTTCACCATTGCTGGAGCTGGG + Intergenic
1112348992 13:98617247-98617269 TTTTAGAAATGGCTGGCTCTAGG + Intergenic
1112790307 13:102995510-102995532 TTTTAGCCACGGCTGGAGCTGGG + Intergenic
1114333059 14:21657625-21657647 TTGTTGCCCAGGCTGGAGCTCGG + Intergenic
1115289277 14:31751984-31752006 TTTTAGCCATGGCTGGAGCCTGG + Intronic
1116296679 14:43119808-43119830 TTTTAGCCATGGCTGGGGAGTGG + Intergenic
1116696379 14:48183230-48183252 TTTTAGCCATAGCTGGAGCTGGG - Intergenic
1117114050 14:52491971-52491993 TGTTAGGCATGTCTGGACCTGGG + Intronic
1119403082 14:74377728-74377750 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1122183830 14:99974332-99974354 TAATAGCCATAGCTGGAGCCTGG + Intronic
1124620534 15:31271527-31271549 ACTTAGCCACGGCTGGAGCATGG + Intergenic
1125597353 15:40895323-40895345 TTTTGGCCTTGGCTATAGCTGGG + Intronic
1125921586 15:43528586-43528608 TTTCAGCCTTGGCTGGGGCAGGG - Exonic
1129229110 15:74186898-74186920 TTTTAGCCCTGGCTGAATCTGGG - Intronic
1129271191 15:74420097-74420119 TTTTGGTCAGAGCTGGAGCTTGG - Intronic
1130170810 15:81511316-81511338 TTTTAACTATGTCTGGAGTTGGG - Intergenic
1131854906 15:96583394-96583416 TTTTAACCATGGCTGGAATTAGG - Intergenic
1132247304 15:100307479-100307501 CTTTAGTCATGGCTGGACCCAGG - Intronic
1134672115 16:16063657-16063679 TTCCAGGCATGGCTGGATCTAGG + Intronic
1135664688 16:24325958-24325980 TTTCAAGCATGGCTGGAGCCAGG + Intronic
1136023209 16:27453215-27453237 TTTCAGGCATGGCTGGATCCGGG - Intergenic
1137687688 16:50398127-50398149 TTTCAGGCATGGCTAGATCTAGG + Intergenic
1137942175 16:52699067-52699089 GTTTAGGCATGGCTGGAGCAAGG + Intergenic
1139177314 16:64704584-64704606 TTTCAGACTTGGCTGGATCTAGG + Intergenic
1139503963 16:67389897-67389919 GGTTAGCCATGCCTGGGGCTGGG + Exonic
1139821553 16:69725431-69725453 TTTATGCCTTGGGTGGAGCTGGG + Intronic
1141536131 16:84681410-84681432 TTTCAGGCATGGCTGGATCCAGG - Intergenic
1142588228 17:987678-987700 TTTCAGCCATGGCTGCAGCCAGG + Intergenic
1143542580 17:7578502-7578524 ATTGAGCCCTGGCTGGGGCTGGG - Exonic
1143962580 17:10732759-10732781 TTTCAGGCATGGCTGGATCCAGG - Intergenic
1144724373 17:17494389-17494411 TTTTAGAGATGGCTGGAGTGGGG - Intergenic
1144848416 17:18231969-18231991 TCTTACCCATGGCTGAAGTTTGG + Intronic
1145369890 17:22299501-22299523 TTTTATCCTTGGCTGGAGTGTGG - Intergenic
1146287419 17:31583221-31583243 TTTCAGGCATGGCTGGATCCAGG - Intergenic
1146899567 17:36574464-36574486 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1147266619 17:39238253-39238275 CTTTGGCCCTGGCTGCAGCTTGG + Intergenic
1148377168 17:47159196-47159218 TTGTAGCCACAGCTGGAGCCCGG + Intronic
1149166236 17:53756994-53757016 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1151406293 17:73889054-73889076 TGTTAGCCAGGGCTGGAGAGTGG - Intergenic
1153107958 18:1549993-1550015 TTTTGGCCACAGCTGGAGCTGGG - Intergenic
1153307184 18:3642471-3642493 TTTTAGCCCTATCTGGAGATAGG + Intronic
1156430474 18:37067873-37067895 TTTTAGCAATGTCTGTAGTTTGG + Intronic
1157069514 18:44389769-44389791 TTTAAGCAATGGCTTGAACTTGG + Intergenic
1157905728 18:51568291-51568313 CTTCAGGCATGGCTGGAGCCAGG + Intergenic
1158554504 18:58464295-58464317 ATTCAGGCATGGCTGGATCTAGG + Intergenic
1159236383 18:65679483-65679505 TTTTAGCCTTGTATGGAGTTTGG - Intergenic
1159601345 18:70431098-70431120 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1161325245 19:3660528-3660550 ATAAAGCCATGGCTAGAGCTAGG + Intronic
1161760147 19:6165133-6165155 TTTCAGGCATGGCTGGAACCAGG + Intronic
1161762755 19:6186625-6186647 CTTCAGGCATGGCTGGATCTGGG + Intronic
1162674093 19:12285158-12285180 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1163084008 19:14965880-14965902 TCTTTGGCATGGTTGGAGCTGGG + Intronic
1163296061 19:16413549-16413571 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1164940476 19:32249214-32249236 TCTTCGCCATTGCTGGAGCATGG + Intergenic
1165920718 19:39296414-39296436 ATTTAGCCATGGCTGCAGCTTGG + Exonic
1167148939 19:47698116-47698138 TTTTAGCCGAGGGTGGAGTTGGG + Intronic
1168156173 19:54473955-54473977 TTTTACCCCTAGCTGGGGCTGGG + Intergenic
926162044 2:10495981-10496003 GTTCAGCCATGGCTGGAAATGGG - Intergenic
929133165 2:38598381-38598403 TTTTAGGAATGGCTGGATCCAGG - Intronic
933663045 2:84943205-84943227 CTTTAGGCATGACTGGATCTAGG - Intergenic
936874455 2:117171954-117171976 TTTTAGCCATGGCTGTAATTAGG - Intergenic
937124586 2:119465372-119465394 CTGTAGGCATGGCTGGATCTAGG - Intronic
937465323 2:122127326-122127348 TTTTAGCCACAGCTGAAACTGGG - Intergenic
937933118 2:127220549-127220571 TTTTGGCCATGGTTGGAAGTGGG - Intergenic
938072416 2:128315706-128315728 TTCTGGCCCAGGCTGGAGCTGGG - Intronic
938280125 2:130057874-130057896 ATTCAGCCATGGCTGGAGCTGGG + Intergenic
938331082 2:130448589-130448611 ATTCAGCCATGGCTGGAGCTGGG + Intergenic
938358866 2:130672914-130672936 ATTCAGCCATGGCTGGAGCTGGG - Intergenic
938435259 2:131279567-131279589 ATTCAGCCATGGCTGGAGCTGGG - Intronic
939012501 2:136863053-136863075 TTTTAGGCAAGGTTGGAGCATGG - Intronic
939081362 2:137665299-137665321 TTTTATCCATGGATGGAATTTGG + Intronic
941319680 2:164039435-164039457 TTTTAGCCATGGCTGGATCCAGG - Intergenic
941549894 2:166901956-166901978 TTTTAGCCAGAGATAGAGCTGGG + Intronic
941869871 2:170372921-170372943 TAGTTGACATGGCTGGAGCTTGG + Intronic
943588577 2:189769377-189769399 TTTTTGAGATGGCTGGAGCCGGG - Intergenic
944480349 2:200151643-200151665 TTGTTGCCTTGGCTGGAGATGGG + Intergenic
945158894 2:206868109-206868131 CTTCAGGCATGGCTGGATCTTGG - Intergenic
945853173 2:215034487-215034509 TTTTAGTCACTGATGGAGCTTGG - Intronic
1168845029 20:938630-938652 CTTCAGGCATGGCTGGATCTAGG + Intergenic
1168856142 20:1010560-1010582 TTTAAGCCATGGAAGGAGTTAGG + Intergenic
1169322563 20:4645490-4645512 TTTAAGCCATGGTTAGAGGTGGG + Intergenic
1169459053 20:5778672-5778694 TTTCAGCCATGACAGGAGCAGGG + Intronic
1170608988 20:17895915-17895937 TATTAGCCGTGGCTACAGCTGGG + Intergenic
1170899364 20:20445606-20445628 TTTTCTCCATGGCTGGGGATGGG + Intronic
1171030699 20:21673965-21673987 TTTCCGTCATGGCTGGTGCTTGG + Intergenic
1171386296 20:24771371-24771393 TTTTACCCATGACTGCAGCTAGG - Intergenic
1172205698 20:33161423-33161445 TTTCAGGCATGGCTGAATCTAGG - Intergenic
1173179840 20:40797716-40797738 TTTTAGCCATGGATGCATATGGG + Intergenic
1173314542 20:41931441-41931463 TTTGAGCCACAGCTGGAGCTGGG + Intergenic
1174170692 20:48616506-48616528 TGTGAGCCATGGATGGAACTTGG + Intergenic
1174427750 20:50444806-50444828 CTGTAGCCCAGGCTGGAGCTCGG - Intergenic
1174582508 20:51582041-51582063 CTTCAGACATGGCTGGATCTAGG - Intergenic
1175304415 20:57966070-57966092 TTGCAGGCATGGCTGGATCTAGG - Intergenic
1175502345 20:59459601-59459623 CTTGAGGCATGGCTGGATCTAGG - Intergenic
1175650485 20:60717161-60717183 TTTCAGTTATGGCTGGATCTGGG - Intergenic
1175820376 20:61905928-61905950 CTTCAGGCATGGCTGGATCTAGG + Intronic
1178107258 21:29334140-29334162 TTTTCGCCCAGGCTGGAGGTCGG + Intronic
1178180023 21:30149352-30149374 TTTTCAGCATCGCTGGAGCTAGG - Intergenic
1182109470 22:27712706-27712728 CTTCAGGCATGGCTGGATCTAGG - Intergenic
1182145648 22:27995225-27995247 TCTTAACCATGGATGGAGCTAGG + Intronic
1182215651 22:28715349-28715371 CTTCAGGCATGGCTGGATCTAGG - Intronic
1183624830 22:38995476-38995498 TGTTGGCCATGGCTGTGGCTGGG - Intergenic
1185153010 22:49177167-49177189 CCTCAGCCATGGCTGCAGCTGGG - Intergenic
949625667 3:5863950-5863972 TTTTAGGCCTGGCTGGGACTTGG - Intergenic
950698370 3:14722074-14722096 TTTCAGGCATGGCTGGATCCAGG + Intronic
951576298 3:24117702-24117724 CTTCAGGCATGGCTGGATCTGGG - Exonic
952978688 3:38718095-38718117 TCTAAGCCATGGCTGCACCTTGG + Intronic
957412786 3:79862325-79862347 TTTTAGCCATGGCTAGACCGGGG - Intergenic
958928050 3:100180051-100180073 TTTTAGTCACAGCTGGAGCTGGG + Intergenic
959365616 3:105454387-105454409 CCTTAGACATGGCTGGATCTGGG + Intronic
960431344 3:117572324-117572346 TTTTAGCCATGGATAAAGATGGG + Intergenic
961613513 3:128160359-128160381 ATTTAGGCATGGCTGGAAATCGG + Intronic
963640731 3:147858494-147858516 TTTGAGCCGCAGCTGGAGCTGGG + Intergenic
963670788 3:148249266-148249288 TTTCAGCCATGGCTAGACCCAGG - Intergenic
965370994 3:167862731-167862753 TTTCATCCATGCCTGGAGCCTGG - Intergenic
966659218 3:182395776-182395798 TTTTGTCCATGGCTGGTGTTTGG - Intergenic
967227094 3:187302423-187302445 TTTAAGCTCTGGCAGGAGCTAGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970886368 4:20991788-20991810 TTGTAGCCATGGCTGGGGCTTGG + Intronic
971166596 4:24190173-24190195 TTGTATCCATGGGTGGAGTTGGG - Intergenic
971243835 4:24911913-24911935 AGTTGGCCTTGGCTGGAGCTTGG + Intronic
971369256 4:26002642-26002664 TTTTGGCCAAGTCTGGGGCTAGG - Intergenic
972063418 4:34910013-34910035 TTTTAGCCATGACTAGAGTCGGG - Intergenic
972879850 4:43410046-43410068 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
974219493 4:58948004-58948026 TTTTAGCCAAGGCTGGATGCAGG + Intergenic
975045619 4:69799622-69799644 TTTTAGCCAAGCATGGTGCTTGG + Intergenic
976000799 4:80371166-80371188 TTTGAGCCACAGCTGGAGCTGGG + Intronic
976680787 4:87753660-87753682 TTTTAGCCATGGCTGGGACGTGG + Intergenic
980168031 4:129252240-129252262 TTTTAGCCATTGGAGCAGCTGGG - Intergenic
981584658 4:146287782-146287804 TATCAGCCATGGCTGCATCTGGG + Intronic
982528208 4:156505887-156505909 TTTTCTCCCTGGCTGGAGCCAGG + Intergenic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
983736671 4:171070471-171070493 TTTTAGCTACAGCTGGGGCTGGG + Intergenic
984680676 4:182605703-182605725 TTTTAGCCAGGGCTTGAAATAGG - Intronic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
986781221 5:11067522-11067544 GGTTAGCCAAGACTGGAGCTGGG + Intronic
987333027 5:16873788-16873810 TTTCAGCCACGGCTGGAGTGTGG + Intronic
987675025 5:21063399-21063421 TTTTAGCCATAGCCGGAGCTGGG - Intergenic
988822667 5:34902833-34902855 TTTTAGCCCTTTCTGGAGATGGG + Intergenic
989434657 5:41397297-41397319 TTGTAACCATGGCTAGAGCTGGG - Intronic
992502632 5:77357350-77357372 CTTTAGCCATGGGTTGAGATGGG + Intronic
992520592 5:77546239-77546261 TTGTAGCCACAGCTGGAGCCTGG - Intronic
993409382 5:87554857-87554879 TTTTAGCCATGGCTGTAGAGAGG + Intergenic
993599441 5:89902612-89902634 CTGTAGCCCAGGCTGGAGCTAGG + Intergenic
994073761 5:95629007-95629029 TTTTAGCCATGACTAGAGCTGGG + Intergenic
995438894 5:112167823-112167845 TTTTATCAATGACTGGAGCAAGG - Intronic
995591615 5:113705792-113705814 TGTGAGCCATGGCTGGGGCTGGG + Intergenic
995732846 5:115264653-115264675 TTGTAGCCACCGCTGGAGCCTGG + Intergenic
997789313 5:136743039-136743061 TTTTAGTCACAGCTGGAGCTGGG - Intergenic
1000963813 5:167631337-167631359 TTTGAGCCAAGGCTTGAACTTGG + Intronic
1001435944 5:171699396-171699418 TTTTAGTCATGGATGAAGTTTGG + Intergenic
1001436599 5:171704155-171704177 TTTCAGGCATGGCTGGATCCAGG - Intergenic
1002444357 5:179280026-179280048 TTGGAGCTATGGCTGGAGCTGGG + Intronic
1002954561 6:1849043-1849065 TTTTAGCAATGTCTGGAGACAGG - Intronic
1007191323 6:40021349-40021371 TTTTGGGAATGGCTGGAGTTTGG - Intergenic
1007669327 6:43538827-43538849 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1009373458 6:62938181-62938203 TTTTAGGCCTGACTGGAGCAAGG - Intergenic
1009769163 6:68122173-68122195 TTTTAGCCATGGCTGGGATGAGG + Intergenic
1010678069 6:78767717-78767739 CTTTAGCCATGGCGGGAGCTGGG - Intergenic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1017807319 6:157956791-157956813 TTTAAGCCCTGGCTGCTGCTTGG - Intergenic
1018003619 6:159600968-159600990 TTATGGCCATGGGTGGGGCTGGG - Intergenic
1019346322 7:532535-532557 TTTCAGGCATGGCTGGATCAGGG + Intergenic
1020095991 7:5369671-5369693 TTTCAGGTATGGCTGGATCTAGG - Intronic
1022504320 7:30901007-30901029 TTTTAGCCACGGCAGGAGCAGGG - Intergenic
1022671174 7:32457749-32457771 TATTGGACATAGCTGGAGCTTGG + Intergenic
1022903207 7:34830872-34830894 TTTGTTCCATGGCTGGAGCTGGG - Intronic
1023644597 7:42296645-42296667 TTTGACCCATTGCTAGAGCTTGG - Intergenic
1026863678 7:73809966-73809988 TTCTGGCCTTAGCTGGAGCTGGG - Intronic
1027395317 7:77747481-77747503 TTTGAGCCACAGCTGGAGCTGGG - Intronic
1027722331 7:81760254-81760276 TTTTAGCCATGGCTGGCAACTGG - Intronic
1031315864 7:120257013-120257035 TTTTAGCTATGGCTGGAGCTGGG - Intergenic
1031665876 7:124481368-124481390 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1034502027 7:151456837-151456859 TTTGAGCCAAAGCTGGAGCTGGG + Intergenic
1037867468 8:22457351-22457373 TTTTTTCCAAGGCTGGATCTCGG + Intronic
1038693540 8:29784451-29784473 TTAGAGCAATGGCTGGAGATTGG - Intergenic
1041111548 8:54487708-54487730 TTTCAAGCATGGCTGGATCTAGG + Intergenic
1041536264 8:58928407-58928429 TTTCAGCCATGGCTTCACCTTGG + Intronic
1042247206 8:66720059-66720081 TGTTAGCCAGGGCTGGGGCATGG - Intronic
1043101977 8:76058887-76058909 TTTGAGCCCTGGCTGAAGCTGGG - Intergenic
1044971409 8:97624208-97624230 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1049572273 8:143374872-143374894 CTTTCGCCATGGCTGGTGCTGGG + Intronic
1049679561 8:143911755-143911777 TTATTTCCTTGGCTGGAGCTGGG - Intergenic
1050935170 9:11386959-11386981 TTTGAGCCACAGCTGGAACTGGG - Intergenic
1050987547 9:12102232-12102254 TTTTAGACAGGGCTGGAGCTGGG + Intergenic
1052285935 9:26785877-26785899 TGGGAGCCATGGCTGGAGCAGGG - Intergenic
1053253758 9:36597146-36597168 TTTTAGAAATGGCTAGAGGTGGG + Intronic
1053434465 9:38066400-38066422 TCTTATGCATGGCTGAAGCTTGG - Intronic
1053444571 9:38141997-38142019 TGTTAGGCATGGCTGGACCTAGG + Intergenic
1053485963 9:38456539-38456561 GTTCAGCCATGGCTGGAGTGAGG + Intergenic
1055993433 9:82131605-82131627 TTGTAGCCATAGCTGGAGCCTGG - Intergenic
1056383179 9:86074137-86074159 TCTCAGCCATGGGAGGAGCTGGG - Intronic
1056630716 9:88290894-88290916 TTTTAGTCATGGGAGGAACTGGG - Intergenic
1057228353 9:93304251-93304273 TTTGTGCCATGGCTGGAGTGGGG + Intronic
1059253756 9:112910200-112910222 TTTAAGCTATGGCTGTCGCTGGG + Intergenic
1059759375 9:117323792-117323814 TTTTAGCCCTTGTTGTAGCTAGG + Intronic
1061949229 9:133926908-133926930 TTGTGGCCAGGGCTGGTGCTGGG - Intronic
1185666809 X:1772093-1772115 CTTTGGCCATGACTGGAGGTGGG + Intergenic
1187439161 X:19302355-19302377 TTTCAGGCAAGGCTGGATCTAGG + Intergenic
1188106823 X:26156442-26156464 TTTTAGCCATGACTGGAGCAGGG + Intergenic
1188259727 X:28008366-28008388 TTTTAGCCAGTGCTGGAGATGGG + Intergenic
1189743379 X:44144293-44144315 TTTTAACTATGACTGGAGCTAGG - Intergenic
1191979382 X:66909237-66909259 TAGTAGCAATGGCTGGAGCTGGG + Intergenic
1192180149 X:68911170-68911192 CTTTAGCCCTGGCTGGAGAGAGG - Intergenic
1192271375 X:69582949-69582971 TTTCAGTCTTGGCAGGAGCTGGG - Intergenic
1193226438 X:78989611-78989633 TCTTAGGCATGACTGGAGCTGGG - Intergenic
1194294635 X:92113204-92113226 ATTGAGCCCTGGCTGGGGCTGGG + Intronic
1197656021 X:129116682-129116704 TTTTGGCCATGGCCAGAGGTGGG + Intergenic
1199243449 X:145575147-145575169 CTTGAGCCATAGCTAGAGCTGGG - Intergenic
1199329570 X:146543088-146543110 TTTGAGCCATGGCTGGAGCTGGG + Intergenic
1199357155 X:146875689-146875711 TTTTAGCCATGGCTTGAGCCTGG - Intergenic
1199878066 X:151950764-151950786 TTTTACCCATGGCCGCTGCTTGG + Intergenic
1200612132 Y:5337707-5337729 ATTGAGCCCTGGCTGGGGCTGGG + Intronic
1201521257 Y:14876212-14876234 TTTTTCCCAAGGATGGAGCTGGG + Intergenic
1201561895 Y:15326513-15326535 TTTTAATCATGGCTGGAGATGGG + Intergenic
1202300744 Y:23411259-23411281 ATTTAGCTATGCCTGAAGCTAGG - Intergenic
1202570067 Y:26259339-26259361 ATTTAGCTATGCCTGAAGCTAGG + Intergenic