ID: 1109305952

View in Genome Browser
Species Human (GRCh38)
Location 13:60641879-60641901
Sequence GTGATAACCCTCCCTACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109305944_1109305952 30 Left 1109305944 13:60641826-60641848 CCATGTGTACAAACATTTATCCC No data
Right 1109305952 13:60641879-60641901 GTGATAACCCTCCCTACCTGGGG No data
1109305946_1109305952 9 Left 1109305946 13:60641847-60641869 CCATGTCATGCAATATGTTTTTC No data
Right 1109305952 13:60641879-60641901 GTGATAACCCTCCCTACCTGGGG No data
1109305945_1109305952 10 Left 1109305945 13:60641846-60641868 CCCATGTCATGCAATATGTTTTT No data
Right 1109305952 13:60641879-60641901 GTGATAACCCTCCCTACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109305952 Original CRISPR GTGATAACCCTCCCTACCTG GGG Intergenic