ID: 1109311494

View in Genome Browser
Species Human (GRCh38)
Location 13:60699717-60699739
Sequence CAGAAACAGCAGAATGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109311494_1109311506 20 Left 1109311494 13:60699717-60699739 CCCCACTCATTCTGCTGTTTCTG No data
Right 1109311506 13:60699760-60699782 AAAGGGGAGCCGCAACTTGGAGG No data
1109311494_1109311503 3 Left 1109311494 13:60699717-60699739 CCCCACTCATTCTGCTGTTTCTG No data
Right 1109311503 13:60699743-60699765 CCTTTAGGGTCAGAGTGAAAGGG No data
1109311494_1109311507 26 Left 1109311494 13:60699717-60699739 CCCCACTCATTCTGCTGTTTCTG No data
Right 1109311507 13:60699766-60699788 GAGCCGCAACTTGGAGGAAAAGG No data
1109311494_1109311504 4 Left 1109311494 13:60699717-60699739 CCCCACTCATTCTGCTGTTTCTG No data
Right 1109311504 13:60699744-60699766 CTTTAGGGTCAGAGTGAAAGGGG No data
1109311494_1109311501 2 Left 1109311494 13:60699717-60699739 CCCCACTCATTCTGCTGTTTCTG No data
Right 1109311501 13:60699742-60699764 TCCTTTAGGGTCAGAGTGAAAGG No data
1109311494_1109311505 17 Left 1109311494 13:60699717-60699739 CCCCACTCATTCTGCTGTTTCTG No data
Right 1109311505 13:60699757-60699779 GTGAAAGGGGAGCCGCAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109311494 Original CRISPR CAGAAACAGCAGAATGAGTG GGG (reversed) Intergenic
No off target data available for this crispr