ID: 1109314756

View in Genome Browser
Species Human (GRCh38)
Location 13:60736819-60736841
Sequence CTATGGTTGTCCACTTCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109314756_1109314759 7 Left 1109314756 13:60736819-60736841 CCACGAGAAGTGGACAACCATAG No data
Right 1109314759 13:60736849-60736871 TCAGAGTTTTTTCCACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109314756 Original CRISPR CTATGGTTGTCCACTTCTCG TGG (reversed) Intergenic