ID: 1109323948

View in Genome Browser
Species Human (GRCh38)
Location 13:60845389-60845411
Sequence GCCTTTGCTCTGATGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109323941_1109323948 26 Left 1109323941 13:60845340-60845362 CCCTGGGCATGCGGAGATTATTG No data
Right 1109323948 13:60845389-60845411 GCCTTTGCTCTGATGTTGGGTGG No data
1109323942_1109323948 25 Left 1109323942 13:60845341-60845363 CCTGGGCATGCGGAGATTATTGT No data
Right 1109323948 13:60845389-60845411 GCCTTTGCTCTGATGTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109323948 Original CRISPR GCCTTTGCTCTGATGTTGGG TGG Intergenic
No off target data available for this crispr