ID: 1109336643

View in Genome Browser
Species Human (GRCh38)
Location 13:61003252-61003274
Sequence CTATGGTAGTGGTGGCCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109336643_1109336654 30 Left 1109336643 13:61003252-61003274 CCTTGTGGCCACCACTACCATAG No data
Right 1109336654 13:61003305-61003327 AATGTTTACTTAAGACCCAAGGG No data
1109336643_1109336648 -1 Left 1109336643 13:61003252-61003274 CCTTGTGGCCACCACTACCATAG No data
Right 1109336648 13:61003274-61003296 GGCCCACATAAATTACTGCCAGG No data
1109336643_1109336653 29 Left 1109336643 13:61003252-61003274 CCTTGTGGCCACCACTACCATAG No data
Right 1109336653 13:61003304-61003326 CAATGTTTACTTAAGACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109336643 Original CRISPR CTATGGTAGTGGTGGCCACA AGG (reversed) Intergenic
No off target data available for this crispr