ID: 1109348561

View in Genome Browser
Species Human (GRCh38)
Location 13:61146126-61146148
Sequence CCTTGGGGCTCTGTGGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109348547_1109348561 18 Left 1109348547 13:61146085-61146107 CCCAGACCCAGGAGCTTCCTAAG No data
Right 1109348561 13:61146126-61146148 CCTTGGGGCTCTGTGGTTTCTGG No data
1109348545_1109348561 30 Left 1109348545 13:61146073-61146095 CCTTTTGTGGGGCCCAGACCCAG No data
Right 1109348561 13:61146126-61146148 CCTTGGGGCTCTGTGGTTTCTGG No data
1109348553_1109348561 -5 Left 1109348553 13:61146108-61146130 CCAAGGCTGTGACACCCTCCTTG No data
Right 1109348561 13:61146126-61146148 CCTTGGGGCTCTGTGGTTTCTGG No data
1109348552_1109348561 1 Left 1109348552 13:61146102-61146124 CCTAAGCCAAGGCTGTGACACCC No data
Right 1109348561 13:61146126-61146148 CCTTGGGGCTCTGTGGTTTCTGG No data
1109348549_1109348561 12 Left 1109348549 13:61146091-61146113 CCCAGGAGCTTCCTAAGCCAAGG No data
Right 1109348561 13:61146126-61146148 CCTTGGGGCTCTGTGGTTTCTGG No data
1109348551_1109348561 11 Left 1109348551 13:61146092-61146114 CCAGGAGCTTCCTAAGCCAAGGC No data
Right 1109348561 13:61146126-61146148 CCTTGGGGCTCTGTGGTTTCTGG No data
1109348548_1109348561 17 Left 1109348548 13:61146086-61146108 CCAGACCCAGGAGCTTCCTAAGC No data
Right 1109348561 13:61146126-61146148 CCTTGGGGCTCTGTGGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109348561 Original CRISPR CCTTGGGGCTCTGTGGTTTC TGG Intergenic
No off target data available for this crispr