ID: 1109351867

View in Genome Browser
Species Human (GRCh38)
Location 13:61192975-61192997
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109351859_1109351867 3 Left 1109351859 13:61192949-61192971 CCTTCATCTGGAGTATATGTGGT No data
Right 1109351867 13:61192975-61192997 TTGGGTGTGAATAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109351867 Original CRISPR TTGGGTGTGAATAAGGAGGG AGG Intergenic
No off target data available for this crispr