ID: 1109356255

View in Genome Browser
Species Human (GRCh38)
Location 13:61232855-61232877
Sequence TAGCTCAGCCAGGATCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109356251_1109356255 10 Left 1109356251 13:61232822-61232844 CCTGAATCACAGAGGACAGAGAA No data
Right 1109356255 13:61232855-61232877 TAGCTCAGCCAGGATCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109356255 Original CRISPR TAGCTCAGCCAGGATCTGCT GGG Intergenic
No off target data available for this crispr