ID: 1109358305

View in Genome Browser
Species Human (GRCh38)
Location 13:61262561-61262583
Sequence AGCAAATATGTCCAGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109358302_1109358305 11 Left 1109358302 13:61262527-61262549 CCCAAGGCACTTGCATGTAAGGT No data
Right 1109358305 13:61262561-61262583 AGCAAATATGTCCAGACAAAAGG No data
1109358303_1109358305 10 Left 1109358303 13:61262528-61262550 CCAAGGCACTTGCATGTAAGGTT No data
Right 1109358305 13:61262561-61262583 AGCAAATATGTCCAGACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109358305 Original CRISPR AGCAAATATGTCCAGACAAA AGG Intergenic
No off target data available for this crispr