ID: 1109358367

View in Genome Browser
Species Human (GRCh38)
Location 13:61263845-61263867
Sequence CTCAAATAGATGAGGTGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109358367_1109358369 -4 Left 1109358367 13:61263845-61263867 CCTTGTCACCTCATCTATTTGAG No data
Right 1109358369 13:61263864-61263886 TGAGAAAACTAGAAATTCATAGG No data
1109358367_1109358370 -3 Left 1109358367 13:61263845-61263867 CCTTGTCACCTCATCTATTTGAG No data
Right 1109358370 13:61263865-61263887 GAGAAAACTAGAAATTCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109358367 Original CRISPR CTCAAATAGATGAGGTGACA AGG (reversed) Intergenic
No off target data available for this crispr