ID: 1109362711

View in Genome Browser
Species Human (GRCh38)
Location 13:61316845-61316867
Sequence GTTCAGCAGCACCATGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109362711_1109362717 23 Left 1109362711 13:61316845-61316867 CCTACCACATGGTGCTGCTGAAC No data
Right 1109362717 13:61316891-61316913 TTTGGCTGAGATGAACAGCAAGG No data
1109362711_1109362714 -7 Left 1109362711 13:61316845-61316867 CCTACCACATGGTGCTGCTGAAC No data
Right 1109362714 13:61316861-61316883 GCTGAACAGCCACTTTGGTTTGG No data
1109362711_1109362716 5 Left 1109362711 13:61316845-61316867 CCTACCACATGGTGCTGCTGAAC No data
Right 1109362716 13:61316873-61316895 CTTTGGTTTGGTGTTTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109362711 Original CRISPR GTTCAGCAGCACCATGTGGT AGG (reversed) Intergenic