ID: 1109370080

View in Genome Browser
Species Human (GRCh38)
Location 13:61412342-61412364
Sequence CTGTCTAAGGAAAAATATGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 308}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109370077_1109370080 12 Left 1109370077 13:61412307-61412329 CCAGCTGAGTAGAAACTGTCAGA 0: 1
1: 0
2: 1
3: 9
4: 132
Right 1109370080 13:61412342-61412364 CTGTCTAAGGAAAAATATGATGG 0: 1
1: 0
2: 0
3: 25
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109370080 Original CRISPR CTGTCTAAGGAAAAATATGA TGG Exonic
901420263 1:9145971-9145993 CTGTCTCAGGAAAAAAAAAAAGG + Intergenic
901706528 1:11077648-11077670 CAGACTAAGGAAAAAAACGAAGG + Exonic
908483679 1:64569482-64569504 CACTCTAAGGAAACAAATGAAGG + Intronic
908606593 1:65804475-65804497 CTGTCTTATGAAAATTAAGAGGG + Intronic
908896006 1:68900152-68900174 CTGGCTTTGGAATAATATGACGG - Intergenic
909966387 1:81916134-81916156 CTGTCTAAGGAAAATTATTGTGG + Intronic
910222633 1:84903623-84903645 CTTTCTGAGGAAATATAGGAAGG + Intergenic
910680607 1:89860400-89860422 CTTACTAAGGAGAAAGATGAAGG - Intronic
912067391 1:105761066-105761088 TTGGCTCAGGATAAATATGACGG + Intergenic
913376384 1:118157250-118157272 CTGTCTCAGAGAAAATATTAAGG + Intronic
914788495 1:150854922-150854944 AAGTCAAAGGAAAAAAATGAAGG + Intronic
915718979 1:157969978-157970000 TAGGCTAAGGAACAATATGATGG - Intergenic
916235112 1:162579285-162579307 CTTACCCAGGAAAAATATGAAGG + Intronic
917311269 1:173681295-173681317 TTGTCTAAGGGAAATTATAATGG - Intergenic
917896362 1:179492076-179492098 CTGTCTAAAAAAATACATGACGG - Intronic
918683342 1:187383109-187383131 CTGTATAGGAAAAAATGTGAAGG + Intergenic
920349244 1:205326977-205326999 CTCTCTAAGCCAAAGTATGAGGG - Intergenic
921568119 1:216745359-216745381 CTGTCTTTGGGAAAAAATGATGG - Intronic
923288401 1:232519690-232519712 CTTTCTAAGGAAAAATACCATGG - Intronic
924127639 1:240872110-240872132 TTCTCTAGGGAAAAAAATGAAGG + Intronic
1062951440 10:1506855-1506877 CCTTCTAAGGAAAAACGTGAGGG + Intronic
1063874500 10:10458891-10458913 CTGTCTTAGGCCAAATATCAGGG + Intergenic
1064126655 10:12667253-12667275 CTGTCAAAGGAATAATACAAGGG - Intronic
1064886240 10:20115527-20115549 CTCTCTCAGGAAAGATATAATGG - Intronic
1065481849 10:26202758-26202780 CTGTTCAAGGTAAGATATGAAGG + Intronic
1066414040 10:35203057-35203079 CTGTCTCAGGAAAAAAAAAAAGG - Intronic
1068022125 10:51598274-51598296 CTCTCAAAGGAAAAAAATAAAGG - Intronic
1068836538 10:61561100-61561122 TTGTCTAAGGAGGAATTTGAAGG - Intergenic
1068923548 10:62511367-62511389 CTTACTAAGAAAAAAGATGAAGG + Intronic
1070508583 10:77139140-77139162 CTTTCAAAGGAAAAGTAAGAAGG + Intronic
1072611458 10:97019977-97019999 CTGTCTAAAAAAAAAAATAAAGG - Intronic
1072776180 10:98196919-98196941 CTGTCTCAAGAAAAAAAAGAAGG - Intronic
1072938914 10:99741568-99741590 CTGTCAAAAGAAAAAAAGGAAGG - Intronic
1073768959 10:106714199-106714221 CTATCTAAGGAAAAAAATCAAGG + Intronic
1074068471 10:110041076-110041098 CTGTCTTTGGAAGAATATGTGGG + Intronic
1075478891 10:122761971-122761993 CTTTCTATGTAAAAAAATGAGGG - Intergenic
1075962815 10:126584113-126584135 CTATCTCAGAAGAAATATGAGGG + Intronic
1076656012 10:132023845-132023867 GAGTCTACGGAAAAATAGGAGGG + Intergenic
1077787388 11:5399008-5399030 CTGTCTTAGGAAAAATGCTAAGG - Intronic
1078267048 11:9762907-9762929 CTCTCCAAGGAAGAAAATGAAGG + Intergenic
1078275652 11:9842973-9842995 CTGTCTTAGGAAAAACGTGCAGG + Intronic
1078554057 11:12304205-12304227 CTGTGAAAGGAAAAATAATAAGG - Intronic
1078976996 11:16488860-16488882 CATTCTAAGTAAAAATATCAGGG + Intronic
1079781639 11:24614176-24614198 CTGTCTAAAAACAAAAATGAAGG + Intronic
1079819647 11:25109327-25109349 CTTTATAAGGAAAAATTTGTAGG - Intergenic
1080810013 11:35694440-35694462 CTTTATAAGGTAAAAGATGAAGG - Intronic
1080957800 11:37121110-37121132 CTGTGTAAGGACAAATCTCATGG - Intergenic
1082161010 11:48887809-48887831 CTGTCTGAGGATGAATCTGAGGG + Intergenic
1082161356 11:48892597-48892619 CTGTCTGAGGATGAATCTGAGGG - Intergenic
1082181081 11:49120458-49120480 CTGTCTCAGGTAAAAACTGAAGG - Intergenic
1087163793 11:94977431-94977453 GTGTCCAAGCAACAATATGAAGG - Intronic
1087600789 11:100312825-100312847 CTGATTCAGGAAAAATAAGAGGG - Intronic
1088947085 11:114525282-114525304 CTATCTAATAAAAAATATAATGG - Intronic
1090886930 11:130885513-130885535 CTGTCTTAGAAAAGAAATGAAGG - Intronic
1093867548 12:24246959-24246981 CTTTCAAAGGAAAAAGATGACGG + Intergenic
1094250588 12:28355591-28355613 ATGTCTAAGGCAAAACATTAAGG - Intronic
1094398228 12:30031886-30031908 CTGTCTCAGGCAAGAAATGATGG + Intergenic
1094570516 12:31637466-31637488 CTGTCTAAGAAAAAAAAAAAAGG - Intergenic
1094834867 12:34317576-34317598 CTGTGTAAGGAAAAATAATGCGG - Intergenic
1095803933 12:46297317-46297339 CTGTCTAAAAAAAAAAAAGAAGG + Intergenic
1096980489 12:55725851-55725873 CTGGCTGAGGAAAAATGTGCTGG - Exonic
1096987382 12:55769113-55769135 CTATTTAAGGTAATATATGAGGG + Intronic
1097785636 12:63755828-63755850 CTTTCTAGGGAAAGGTATGAAGG - Intergenic
1098935119 12:76469993-76470015 CTATTTAAGGAAAAGAATGAGGG - Intronic
1099111155 12:78562987-78563009 CTCTCTATGGCAATATATGAAGG - Intergenic
1099290012 12:80764877-80764899 CATTCTAAGGGAAAGTATGAAGG - Intergenic
1100790147 12:98121242-98121264 ATTTCAAAGGAAAAATATAATGG + Intergenic
1101399920 12:104378287-104378309 CTGTCTAAGGGAAAATGAGTAGG + Intergenic
1101554112 12:105791132-105791154 CTGTCTAAGGTAAAACATTTTGG + Intergenic
1104366079 12:128178742-128178764 CTGTCTCAGAAAAAATGTGAAGG + Intergenic
1104680021 12:130743654-130743676 AGGTCTAAGCAAAAATCTGACGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106943046 13:34798153-34798175 CTATGTAATGAAAAAAATGATGG + Intergenic
1107217582 13:37939728-37939750 GTGTTCAAGGAAAAATATGATGG - Intergenic
1108606040 13:52039675-52039697 AGGTCTAAGTAAAAACATGATGG - Intronic
1109186608 13:59276743-59276765 CTCCATAAGGAATAATATGATGG + Intergenic
1109370080 13:61412342-61412364 CTGTCTAAGGAAAAATATGATGG + Exonic
1110285575 13:73746534-73746556 CTGTCTTTGGAAGAATATAAAGG - Intronic
1110516637 13:76420483-76420505 CTGTGAAAGGAAAACTATGAAGG - Intergenic
1110613939 13:77520435-77520457 GTGTCTCAGGAATAATATTATGG + Intergenic
1111881953 13:93968673-93968695 CAGTCTAAGGAAACCTATAAAGG - Intronic
1112421692 13:99256954-99256976 CTCTTTAAGGAAAACTATGGGGG + Intronic
1113084302 13:106551875-106551897 CTCTCTAAGAAAACATGTGATGG + Intronic
1113506102 13:110817069-110817091 CTGTTTAAGGAAAAAGAATAAGG + Intergenic
1113973386 13:114207810-114207832 CTCTCTAGGGAAAAAAATGGTGG - Intergenic
1114074007 14:19142278-19142300 CTGGCTAGGGAAATATATAAAGG + Intergenic
1114088259 14:19257694-19257716 CTGGCTAGGGAAATATATAAAGG - Intergenic
1114266429 14:21075018-21075040 CTGGTTAAGGAGGAATATGAAGG + Exonic
1115981752 14:39059466-39059488 CTGTCTTATGAGAAATATTATGG - Intronic
1117163675 14:53013281-53013303 TTGTCAAAATAAAAATATGAAGG - Intergenic
1117496953 14:56314868-56314890 CTGTCTTTGCAAAATTATGACGG + Intergenic
1117563514 14:56969619-56969641 CAGTTTGAGGAAGAATATGATGG - Intergenic
1118241872 14:64068061-64068083 ATGTCTAAGGAAAATCATCAAGG + Intronic
1120458879 14:84767884-84767906 CTGTCTTAGGTAAAATATAATGG + Intergenic
1122177220 14:99929892-99929914 CAGTCTCAGGAAAGCTATGAGGG + Intronic
1122219304 14:100225982-100226004 CTGTCTAAAAAAAAATAGGCTGG + Intergenic
1123138653 14:106054362-106054384 CTGACTTAGGAAAAAAATGATGG - Intergenic
1123677046 15:22720613-22720635 CTGCCTAAGTAATAATATAACGG - Intergenic
1124329262 15:28794890-28794912 CTGCCTAAGTAATAATATAACGG - Intergenic
1124725315 15:32151394-32151416 CTGACCAAGGAAATATATGTTGG + Intronic
1131287047 15:91068754-91068776 CTGTCTCAGAAAAAAAAAGAAGG - Intergenic
1134377864 16:13695169-13695191 CAGACTAAGGAAAAAGAGGAGGG + Intergenic
1135224441 16:20643279-20643301 AATTCTAAGGAAAAATAGGAAGG + Intronic
1135506229 16:23039034-23039056 CTGTCTAAAAATACATATGAGGG - Intergenic
1135951945 16:26922590-26922612 CTGGCCAATGAAACATATGAGGG - Intergenic
1137334060 16:47531000-47531022 TTGGAGAAGGAAAAATATGAAGG + Intronic
1137442229 16:48507313-48507335 CTGTCTCAGGAAAAATTTTAAGG - Intergenic
1138226358 16:55298796-55298818 GTGTCTCAGGAAAAGTAAGAGGG - Intergenic
1138653132 16:58473158-58473180 CTTTCTAAAGAAAGAAATGAAGG - Intronic
1139698245 16:68690606-68690628 CTGTCTAAAAAAAAAATTGAAGG + Intronic
1140931283 16:79630595-79630617 CTCTCCCAGGAAAAGTATGAAGG + Intergenic
1142436667 16:90063593-90063615 CTGGGTAAGAAAAAATTTGAGGG - Exonic
1143965098 17:10751389-10751411 CTGTCTAATGAAGAAAGTGATGG - Intergenic
1145197582 17:20908377-20908399 CTGTGTAACAAAAAATATGTTGG + Intergenic
1145363506 17:22231636-22231658 CTGTCTAAAAAAAAATATTTTGG + Intergenic
1146128440 17:30248819-30248841 CTGTTAAAGGAAAAAAAAGAGGG - Exonic
1146846602 17:36185174-36185196 CTATCTAAGGAAACAAAGGAGGG - Intronic
1148245713 17:46028900-46028922 GTTACTAAGGAATAATATGATGG - Intergenic
1148649456 17:49239151-49239173 CTGTCTCAGAAACAAAATGAGGG - Intergenic
1150926803 17:69540943-69540965 ATTTCTCAGGAAAAAGATGATGG - Intronic
1153286746 18:3463634-3463656 CTGTCTCAGGAAAAAAAAAAAGG - Intergenic
1153580859 18:6571959-6571981 CTGTCTAGGGAGAAAGATGATGG - Intronic
1153882884 18:9435940-9435962 CTGTCTAAAAAAAAAAAAGAAGG + Intergenic
1154283854 18:13033430-13033452 CTGTCTTAGCAAAGATGTGAGGG + Intronic
1155492759 18:26416349-26416371 AGGTCTATGGAAAAAGATGATGG + Intergenic
1156090150 18:33457366-33457388 GTGTCAGAGGAAAAATTTGAAGG - Intergenic
1157105990 18:44774916-44774938 CTGACTAAGGAAAAAGAAAAAGG - Intronic
1158928623 18:62297854-62297876 ATGTTTAAGTAAAAACATGAAGG - Intronic
1159415754 18:68146465-68146487 ATTTCTATGGAAAAATATAATGG + Intergenic
1160111542 18:76036930-76036952 CTTTCTATTGAAAAAGATGATGG - Intergenic
1162113522 19:8414272-8414294 CTGTCTAAAAAAAAAAAAGACGG - Intronic
1162246838 19:9408077-9408099 TTGGCTAGGGAAAAAAATGAAGG - Intergenic
1165286383 19:34846221-34846243 CTGTCTCAAAAAAAATAAGAAGG - Intergenic
1167281500 19:48571919-48571941 GTGTTTAATGAAAACTATGATGG + Intronic
926529412 2:14024245-14024267 CTTTCTAATAAAAAATATTATGG - Intergenic
927196751 2:20553114-20553136 CTGTCTAAAAAAAAAAATAAAGG - Intergenic
928296456 2:30088348-30088370 CTGACATAGGAAAATTATGATGG + Intergenic
929049478 2:37823796-37823818 TTTTCAAAGGAAAAATATGGTGG + Intergenic
929086835 2:38176414-38176436 CTGTCTAACTAAAATTATGAAGG + Intergenic
930355859 2:50318810-50318832 CTATCTCAGGATAAATAAGAGGG + Intronic
932122663 2:69115851-69115873 ATGTCTAAGGAAAAGGATGGTGG + Intronic
933150268 2:78906227-78906249 CTGACGAACCAAAAATATGAAGG + Intergenic
934157575 2:89217845-89217867 CTGTTTCAGGAAAAAAATGCAGG + Intergenic
934638142 2:96009728-96009750 CTGTCTAAGGAAAGGTATCTGGG - Intergenic
934757735 2:96836086-96836108 CTGTCTCAGGAAAAAAAAAAGGG - Intronic
934788616 2:97036408-97036430 CTGTCTGAGGCTAAATCTGAGGG + Intergenic
935005574 2:99072860-99072882 CTGTCTAAGGAACTAAAAGAGGG - Intronic
935020214 2:99223065-99223087 CTGTGTAAGTAAAAATAGGATGG - Intronic
935092322 2:99907396-99907418 GTGTCTAAGGAATAATATTTTGG - Intronic
935801955 2:106706825-106706847 CTGTATCAGGAGGAATATGACGG + Intergenic
937335850 2:121062011-121062033 CTTTTTAAGCCAAAATATGAAGG - Intergenic
939121272 2:138120485-138120507 CTCTCTAAGGAAAAGTTTTAAGG - Intergenic
939674967 2:145061178-145061200 CTGCCTTAGGCAGAATATGATGG - Intergenic
940017157 2:149118940-149118962 CTGTCAAAGGTAAAAAATGCAGG + Intronic
940579804 2:155564177-155564199 ATGTCTGAGGAAAAGTAAGAAGG + Intergenic
941193920 2:162422714-162422736 AAGTTGAAGGAAAAATATGAAGG + Intronic
941673061 2:168315812-168315834 CTGTGTGAGGAAAAATGAGAAGG + Intergenic
941772118 2:169356213-169356235 CTGTCTGAGGCAAAAAAGGAAGG - Intronic
941783407 2:169473762-169473784 CTGTAGAAGGCAAAATATGAAGG + Intergenic
942291175 2:174472740-174472762 CTGTCAGAGGATAAAGATGATGG - Intronic
942985181 2:182132163-182132185 CTGTCTGAGGAAAGGTTTGATGG + Intergenic
944098342 2:195994933-195994955 CTGTCTAAAGAAAAGGAAGAAGG - Intronic
944164332 2:196702242-196702264 CTGTCTCTAGAAAAAAATGAAGG + Intronic
945129723 2:206557616-206557638 CTGGCTAAGGAATTATAGGATGG + Intronic
945265768 2:207889806-207889828 CTGTCTCAAAAAAAATAAGAGGG - Intronic
946971329 2:225095200-225095222 CTGTCTAAGCAAAAAAAAAAAGG - Intergenic
1169639802 20:7738782-7738804 CTGAGAAAGGAAAAATATAAGGG - Intergenic
1170188591 20:13620513-13620535 CTGCCTAAGTAATAATATAACGG + Intronic
1177544106 21:22534545-22534567 CTGGCTAAGGAAAGATCTTATGG - Intergenic
1179252633 21:39685320-39685342 CAGTCTAAAGAAAAAAATGAAGG - Intergenic
1179769118 21:43600545-43600567 CTGTCTAATGAAAAATTGGTAGG - Intronic
1180289656 22:10835216-10835238 CTGGCTAGGGAAATATATAAAGG + Intergenic
1180492453 22:15864636-15864658 CTGGCTAGGGAAATATATAAAGG + Intergenic
1180694829 22:17744982-17745004 TTTTCTAATGAAAAATATTATGG - Intronic
1185212695 22:49580261-49580283 CTATCTAGGGAAAAACATAAAGG - Intronic
951385754 3:22040164-22040186 ATGTGTAAGGAAAATCATGAGGG - Intronic
951523239 3:23629033-23629055 CTGTATAAGGGAAAATAGGGAGG + Intergenic
951782649 3:26381585-26381607 CCGTCAAAGAAAAAATATTAGGG - Intergenic
951933813 3:27999847-27999869 CTTTCTAAAGAAAGACATGAGGG + Intergenic
952555337 3:34523775-34523797 AATTCTAAGGAAAAATAGGACGG + Intergenic
952593304 3:34984284-34984306 ATGTTTTAGAAAAAATATGAAGG + Intergenic
952719389 3:36516280-36516302 ATGTCAAAGGGAAAATATGAGGG - Intronic
952726366 3:36590224-36590246 CTCTCTAACCAAATATATGATGG - Intergenic
955456805 3:59130736-59130758 ATGTCTAAGCATAAATAAGATGG - Intergenic
955862387 3:63345392-63345414 CTGACTATGCAAAATTATGACGG - Intronic
956031193 3:65039889-65039911 CTGGCTAAGAACAGATATGAGGG - Intergenic
956062698 3:65363995-65364017 CTGATCAAGGAAAATTATGAAGG + Intronic
956324400 3:68035348-68035370 CAACCTAAGGAAAAGTATGAGGG - Intronic
957028336 3:75210816-75210838 TTGTATAAGTAAAAATATAAAGG - Intergenic
957381952 3:79442852-79442874 TTTTCTAAGGGAAAATATGCAGG + Intronic
959780053 3:110220286-110220308 ATGTTTAAGGAAATATATGGGGG + Intergenic
959840866 3:110972626-110972648 ATGGCTGTGGAAAAATATGATGG + Intergenic
960270131 3:115664773-115664795 CAGTTTAAGGAAAAATATGCAGG - Intronic
960290335 3:115876782-115876804 ATGTGTGAGGAAAAATATGTTGG + Intronic
960881965 3:122354509-122354531 TTCTCTAAGGACAAATATGCTGG - Intergenic
961235186 3:125360257-125360279 CTGTCTAAAAAAAAAGATGAAGG - Intronic
963412368 3:144946362-144946384 ATGTCTGAGGTAAAATAAGAGGG + Intergenic
964274345 3:154992914-154992936 TTGTATAGGGTAAAATATGAAGG - Intergenic
965437381 3:168669037-168669059 CTGTGTCTGGGAAAATATGAGGG + Intergenic
965637464 3:170798226-170798248 CTGAAAAAGGAAAACTATGATGG + Intronic
965746215 3:171928886-171928908 CTGTCTCAGGAAAAAAAAGGGGG + Intronic
967499421 3:190180003-190180025 TTTTCAAAGGAAAAGTATGAGGG + Intergenic
968161036 3:196427082-196427104 CAGTCTAAGGACAAATGTGAGGG - Intronic
969007871 4:4036294-4036316 CTGTCTAAGAAAAAAAAAAAAGG - Intergenic
969063071 4:4454676-4454698 CTGTCAAAAGAAAAATATCTGGG - Intronic
970853439 4:20628904-20628926 AAGTCTAAGGAAAAACAAGAAGG - Intergenic
971011341 4:22439172-22439194 ATGTTTAAGGTAAAATATAAAGG + Intronic
971546621 4:27894525-27894547 ATGTCTAAGGAAAATATTGAAGG - Intergenic
971672005 4:29573123-29573145 CTGTCAAAAGATAAATATGTAGG + Intergenic
971768232 4:30862149-30862171 CAGTTTAAGGAAATATATCATGG - Intronic
972872842 4:43321544-43321566 CTTTCTAAGCAAATCTATGAGGG + Intergenic
974792298 4:66707961-66707983 CTATTTAATGAAAATTATGATGG + Intergenic
975481808 4:74889356-74889378 CTGTCTAAGAAAACACCTGAAGG + Intergenic
976020518 4:80618503-80618525 CTGTATTAGGAAAAAAATGAAGG + Intronic
976145060 4:82034172-82034194 CTGTGTAAGGTAAAATATACTGG + Intronic
976966494 4:91048327-91048349 ATGTCAGAGGAAAAAAATGAAGG - Intronic
978842644 4:113232901-113232923 CTGCCTAAGCAAAAATGAGAGGG - Intronic
980761785 4:137244275-137244297 CTGTATAAGGAAAAAGCTCATGG + Intergenic
981230472 4:142348391-142348413 CTGTTTAAGGTAAAATATTCTGG - Intronic
981252713 4:142623447-142623469 GTGACTGTGGAAAAATATGAAGG - Intronic
982812067 4:159838326-159838348 CTGTCTGTGTCAAAATATGACGG + Intergenic
982878366 4:160676445-160676467 CTGAGTAAGGATAAATGTGAAGG + Intergenic
983832946 4:172352949-172352971 CTGTCTAAGCAAAAGTAAGCTGG - Intronic
983960400 4:173746141-173746163 CTTTCTAATGAAAAATAGCATGG - Intergenic
983966796 4:173822652-173822674 CTGTCTTAGAAATAATTTGAAGG - Intergenic
985186557 4:187323449-187323471 CTTTTTAAGGAAAAATATCATGG - Intergenic
985878204 5:2617147-2617169 CTCTCTAAAGAATAATATGTTGG - Intergenic
986000141 5:3624081-3624103 CACTCAAAGGAAAAATATGCAGG + Intergenic
987719547 5:21616417-21616439 CTGTATAAGGCAAGGTATGAGGG - Intergenic
988254601 5:28805246-28805268 GTCTTTAAAGAAAAATATGATGG + Intergenic
989326535 5:40202785-40202807 ACATCTGAGGAAAAATATGAAGG - Intergenic
990264300 5:54059108-54059130 CAGATTAAGGAAAAATAGGAGGG - Intronic
990774890 5:59295304-59295326 GTGACCCAGGAAAAATATGAGGG + Intronic
991158643 5:63468603-63468625 CTATCTTAAGAAAAATATAATGG + Intergenic
991496586 5:67232798-67232820 CTGTCTTTGCAAAAGTATGATGG + Intergenic
993575497 5:89594653-89594675 TTATCTAAAGTAAAATATGAAGG + Intergenic
994180692 5:96762714-96762736 ATGTATAAGAAAAAATATAAAGG - Exonic
994305482 5:98198868-98198890 GTTTTTCAGGAAAAATATGATGG - Intergenic
995143711 5:108762755-108762777 CTATCTAAGGAAAAACAAGGAGG - Intronic
995364150 5:111335908-111335930 TTGTGTAATGAAAAATATGGTGG + Intronic
995439104 5:112170514-112170536 GTGTTCAAGGAAAAATAGGAGGG + Intronic
996903609 5:128573297-128573319 CCATCAAAGCAAAAATATGAGGG - Intronic
998277346 5:140769406-140769428 CTGTCTAGGGAAACAACTGAAGG - Intergenic
998445159 5:142192722-142192744 CTATCTCAGGAAGGATATGATGG - Intergenic
999128655 5:149265805-149265827 ATGTTTATGGAAAAATATTAAGG - Intergenic
999718067 5:154378002-154378024 GTTTCTATGGAAATATATGAGGG + Intronic
999812446 5:155140512-155140534 TTGTGGAAGGAAAAACATGAAGG + Intergenic
1000576109 5:162977038-162977060 GTGTCAAAGGAAAATAATGATGG - Intergenic
1000609479 5:163358773-163358795 CTGTCACAAGAACAATATGAAGG - Intergenic
1000645368 5:163754944-163754966 CTGACAATGGAAGAATATGAAGG + Intergenic
1001069348 5:168570690-168570712 AAGTCTAAGGAAATAGATGAAGG + Intronic
1002203225 5:177543687-177543709 CTGCCAAAGCAAAAATTTGAAGG - Intronic
1002516628 5:179763816-179763838 CTGTCTAAAGATAATAATGAGGG + Intronic
1003047133 6:2744226-2744248 CTTTAAAAGGAAAAATACGATGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004211767 6:13654426-13654448 CTATATAAGGAAAAATAGAAAGG - Intronic
1004307263 6:14512318-14512340 CAGTCGAAAGAAAAAAATGATGG + Intergenic
1004649692 6:17597771-17597793 CTTTTTAAGGAAAAAAATTATGG + Intergenic
1005222568 6:23603996-23604018 CTTTAAAATGAAAAATATGAGGG + Intergenic
1007957170 6:45928699-45928721 CTGTCTAAGGAGGTATGTGATGG + Intronic
1008532387 6:52475427-52475449 GTGCCTAAGTAAAAATATGCTGG + Intronic
1009159305 6:60261771-60261793 CTGTCTTTGGAAAAATTTAAAGG - Intergenic
1012249200 6:96961011-96961033 CTGGATCAGGAAAAAAATGAAGG + Intronic
1013043644 6:106461744-106461766 CTCTCTCGGGAAAAATAGGAAGG + Intergenic
1013183140 6:107734794-107734816 AAGTGTCAGGAAAAATATGAAGG + Intronic
1014721484 6:124922670-124922692 CTGTCTCAGAAAAAAAATGCTGG - Intergenic
1014845549 6:126271612-126271634 CTGTCTAAAAGAAAATATGTAGG + Intergenic
1015134192 6:129849473-129849495 CTGTCAAATGAAAAAAATGGAGG - Intronic
1016135890 6:140542516-140542538 CTTTCTTAAGAAAAAGATGAGGG - Intergenic
1018941743 6:168313049-168313071 CCGTCTAAAAAAAAATATTATGG - Intronic
1019930510 7:4219836-4219858 CCGTCTCAGGAATGATATGAAGG - Intronic
1021265963 7:18523051-18523073 CTTTCAAAGGAAATAAATGAAGG + Intronic
1022171173 7:27833365-27833387 CTTTCTAAAGAAAAACATCAGGG + Intronic
1022577422 7:31511441-31511463 ATGTCTAAGGATCAAGATGAAGG - Intergenic
1023784005 7:43687400-43687422 CTCTCTCAGGACAAATATGGTGG - Intronic
1024402544 7:48941609-48941631 CTGTAAAATGAAAAACATGAAGG + Intergenic
1025073184 7:55919103-55919125 CTGCCTAAAGTAAAATGTGAGGG + Intronic
1026415741 7:70178790-70178812 CTGTCTAAAAAAAAAAATGTAGG + Intronic
1027950156 7:84804924-84804946 CAGTCTCAGGAACAAAATGAGGG - Intergenic
1030252932 7:107468127-107468149 CTCTCTTTGGAAAATTATGAAGG - Intronic
1031207903 7:118784987-118785009 CTGGTTAAGGAAAAATGAGATGG + Intergenic
1031670090 7:124531199-124531221 TTGTGTCAGGAAAAACATGATGG - Intergenic
1031726347 7:125244449-125244471 CTGTACCAGTAAAAATATGAAGG - Intergenic
1031839406 7:126718907-126718929 TTCTTTAAGGAAAAATATTAGGG + Intronic
1032682461 7:134199277-134199299 ATGAACAAGGAAAAATATGAGGG + Exonic
1033041468 7:137922899-137922921 CTCTTAAAGGAAAAATATAATGG + Intronic
1033882614 7:145903880-145903902 CAGGCTGAGGAAAAATATAAGGG - Intergenic
1034646058 7:152648579-152648601 CTGTCTTAAGAAAAATTTTAAGG + Exonic
1034840998 7:154396618-154396640 CTGTGTAATGAAAAATATCAGGG - Intronic
1035285212 7:157801648-157801670 TTCTCTAGGGAAAAATTTGATGG + Intronic
1035842263 8:2825827-2825849 CTGACCAAGGAACAATTTGAGGG - Intergenic
1037157169 8:15716323-15716345 CTGATTAAGGACAAATCTGAGGG + Intronic
1037226934 8:16603499-16603521 TTGTTTAAGGATAAATATAAGGG - Intergenic
1037267525 8:17082173-17082195 ATTTCTTAGGAAATATATGAAGG + Intronic
1038169435 8:25115705-25115727 CCTTCTAAGGATACATATGATGG - Intergenic
1039002919 8:33001667-33001689 CTTTCAAAGCAAGAATATGAAGG + Intergenic
1039895140 8:41711927-41711949 CTGTCTAAAAAAAAAAAAGATGG - Intronic
1041416772 8:57618738-57618760 CTGTCTAAGGAAAAAGTTATTGG + Intergenic
1042397482 8:68309075-68309097 CTGTCTCTGCAAAATTATGATGG + Intronic
1043051977 8:75395679-75395701 ATGTATTTGGAAAAATATGAGGG - Intergenic
1044151440 8:88781400-88781422 ATGTCTCAGGAAAAATATGCTGG - Intergenic
1044747630 8:95386005-95386027 ATGTCTAAGCAAAACTATTAAGG - Intergenic
1045973279 8:108103697-108103719 CTAGCAAAGGAAAACTATGAGGG + Intergenic
1046287159 8:112109088-112109110 ATGTTTATGGAAAAATATTAAGG + Intergenic
1046783856 8:118244901-118244923 ATGTCCAAGGATAAATCTGAAGG + Intronic
1047789486 8:128188053-128188075 ATGTCTCAGGAAATACATGATGG - Intergenic
1050641870 9:7677053-7677075 CTGTTCATGGAAAAAAATGAGGG - Intergenic
1051691492 9:19717936-19717958 ATGTCTAAAGACAAATATAATGG + Intronic
1052247795 9:26358875-26358897 CTTTGTAATAAAAAATATGATGG - Intergenic
1052566278 9:30156651-30156673 ATTTCTAAGGAAAAAAATGCAGG - Intergenic
1055505357 9:76942557-76942579 TTGTCAGAGAAAAAATATGAAGG - Intergenic
1059524899 9:114981772-114981794 CTGCTTTAGGAAAAATATAAAGG - Intergenic
1059835939 9:118152657-118152679 TTGTTTAAAGAAAAACATGATGG + Intergenic
1059980768 9:119769492-119769514 CTGTGACAGAAAAAATATGATGG - Intergenic
1060949229 9:127590526-127590548 CTGTCTCAGGAAAAAAAAAAAGG - Intergenic
1061698925 9:132400327-132400349 CTGTCTCACGAAAAAAAAGAAGG - Intronic
1186217792 X:7318441-7318463 CTGCCTATGGAAAAACATGTTGG - Intronic
1187308616 X:18119902-18119924 CTAACTAAGAAAAAATTTGAAGG + Intergenic
1187426685 X:19183777-19183799 CTGTCTCATGAAAAATTTAAAGG + Intergenic
1187507992 X:19892466-19892488 CTGACTAGGGGAAAATATCAAGG + Intergenic
1188227282 X:27615432-27615454 CTGACAAAGCAAAAATTTGAAGG - Intronic
1188377773 X:29453994-29454016 TTGTCTAAGGAAAAAAATTCAGG - Intronic
1189284101 X:39839729-39839751 CTGTCTAAGAAAAAATAAAAAGG - Intergenic
1194414206 X:93590434-93590456 CTGGCGAAGGAAAAGTAAGATGG + Intergenic
1194451880 X:94053602-94053624 GAGTCTTAGGTAAAATATGAAGG - Intergenic
1194580275 X:95663342-95663364 TTGTATAAGGAAACATATTAGGG + Intergenic
1194928299 X:99855822-99855844 ATATTTAAGGTAAAATATGACGG - Intergenic
1195433877 X:104819918-104819940 ATCTCTAAGTATAAATATGAGGG + Intronic
1195686083 X:107587777-107587799 CTGTCTAAAAAAAAATATTGAGG - Intronic
1196669781 X:118353318-118353340 CTGACTGAGGAAAAACATCAGGG - Intronic
1198585693 X:138118280-138118302 CTGTGTTAGCAAAAATATGAAGG - Intergenic
1199702523 X:150393150-150393172 CTGGAAAAGGAAAACTATGAAGG - Intronic
1199821775 X:151456769-151456791 CTGTCTCAAAAAAAAAATGAGGG + Intergenic
1201961684 Y:19687885-19687907 CTGTGTAAGTAACAAAATGAAGG - Intergenic