ID: 1109372179

View in Genome Browser
Species Human (GRCh38)
Location 13:61437197-61437219
Sequence TAGTTTTGCAACTCAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109372178_1109372179 14 Left 1109372178 13:61437160-61437182 CCAAACTACAAGTTTCTTGTATC No data
Right 1109372179 13:61437197-61437219 TAGTTTTGCAACTCAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109372179 Original CRISPR TAGTTTTGCAACTCAGAGCA AGG Intergenic
No off target data available for this crispr