ID: 1109376026

View in Genome Browser
Species Human (GRCh38)
Location 13:61494309-61494331
Sequence CCTTATAAGAAGAGGAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3138
Summary {0: 9, 1: 140, 2: 478, 3: 958, 4: 1553}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109376026_1109376030 -1 Left 1109376026 13:61494309-61494331 CCAGATTTCCTCTTCTTATAAGG 0: 9
1: 140
2: 478
3: 958
4: 1553
Right 1109376030 13:61494331-61494353 GACATTTTTCAGATTGATTAGGG No data
1109376026_1109376029 -2 Left 1109376026 13:61494309-61494331 CCAGATTTCCTCTTCTTATAAGG 0: 9
1: 140
2: 478
3: 958
4: 1553
Right 1109376029 13:61494330-61494352 GGACATTTTTCAGATTGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109376026 Original CRISPR CCTTATAAGAAGAGGAAATC TGG (reversed) Intergenic
Too many off-targets to display for this crispr