ID: 1109376026 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:61494309-61494331 |
| Sequence | CCTTATAAGAAGAGGAAATC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3138 | |||
| Summary | {0: 9, 1: 140, 2: 478, 3: 958, 4: 1553} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1109376026_1109376030 | -1 | Left | 1109376026 | 13:61494309-61494331 | CCAGATTTCCTCTTCTTATAAGG | 0: 9 1: 140 2: 478 3: 958 4: 1553 |
||
| Right | 1109376030 | 13:61494331-61494353 | GACATTTTTCAGATTGATTAGGG | No data | ||||
| 1109376026_1109376029 | -2 | Left | 1109376026 | 13:61494309-61494331 | CCAGATTTCCTCTTCTTATAAGG | 0: 9 1: 140 2: 478 3: 958 4: 1553 |
||
| Right | 1109376029 | 13:61494330-61494352 | GGACATTTTTCAGATTGATTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1109376026 | Original CRISPR | CCTTATAAGAAGAGGAAATC TGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||