ID: 1109381723

View in Genome Browser
Species Human (GRCh38)
Location 13:61569973-61569995
Sequence AACCATATGAAGGTTCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109381723_1109381725 5 Left 1109381723 13:61569973-61569995 CCAAGAAGAACCTTCATATGGTT No data
Right 1109381725 13:61570001-61570023 AAACTTCAAAGATTTGTCACAGG No data
1109381723_1109381726 22 Left 1109381723 13:61569973-61569995 CCAAGAAGAACCTTCATATGGTT No data
Right 1109381726 13:61570018-61570040 CACAGGAAGTACTCCTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109381723 Original CRISPR AACCATATGAAGGTTCTTCT TGG (reversed) Intergenic
No off target data available for this crispr