ID: 1109389262

View in Genome Browser
Species Human (GRCh38)
Location 13:61671364-61671386
Sequence GGCAGAAGCCCTTTAGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109389262_1109389267 6 Left 1109389262 13:61671364-61671386 CCGTCTGCTAAAGGGCTTCTGCC No data
Right 1109389267 13:61671393-61671415 TCAAATCCGAGGTTCCGCCCTGG No data
1109389262_1109389269 12 Left 1109389262 13:61671364-61671386 CCGTCTGCTAAAGGGCTTCTGCC No data
Right 1109389269 13:61671399-61671421 CCGAGGTTCCGCCCTGGAAGAGG No data
1109389262_1109389272 17 Left 1109389262 13:61671364-61671386 CCGTCTGCTAAAGGGCTTCTGCC No data
Right 1109389272 13:61671404-61671426 GTTCCGCCCTGGAAGAGGAGGGG No data
1109389262_1109389270 15 Left 1109389262 13:61671364-61671386 CCGTCTGCTAAAGGGCTTCTGCC No data
Right 1109389270 13:61671402-61671424 AGGTTCCGCCCTGGAAGAGGAGG No data
1109389262_1109389263 -5 Left 1109389262 13:61671364-61671386 CCGTCTGCTAAAGGGCTTCTGCC No data
Right 1109389263 13:61671382-61671404 CTGCCCGCCGTTCAAATCCGAGG No data
1109389262_1109389271 16 Left 1109389262 13:61671364-61671386 CCGTCTGCTAAAGGGCTTCTGCC No data
Right 1109389271 13:61671403-61671425 GGTTCCGCCCTGGAAGAGGAGGG No data
1109389262_1109389274 22 Left 1109389262 13:61671364-61671386 CCGTCTGCTAAAGGGCTTCTGCC No data
Right 1109389274 13:61671409-61671431 GCCCTGGAAGAGGAGGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109389262 Original CRISPR GGCAGAAGCCCTTTAGCAGA CGG (reversed) Intergenic
No off target data available for this crispr