ID: 1109391977

View in Genome Browser
Species Human (GRCh38)
Location 13:61705518-61705540
Sequence GCACCATCAGTTTTCTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109391972_1109391977 -10 Left 1109391972 13:61705505-61705527 CCCAGCTCCATCTGCACCATCAG No data
Right 1109391977 13:61705518-61705540 GCACCATCAGTTTTCTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109391977 Original CRISPR GCACCATCAGTTTTCTTGGG TGG Intergenic
No off target data available for this crispr