ID: 1109391978

View in Genome Browser
Species Human (GRCh38)
Location 13:61705519-61705541
Sequence CACCATCAGTTTTCTTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109391972_1109391978 -9 Left 1109391972 13:61705505-61705527 CCCAGCTCCATCTGCACCATCAG No data
Right 1109391978 13:61705519-61705541 CACCATCAGTTTTCTTGGGTGGG No data
1109391973_1109391978 -10 Left 1109391973 13:61705506-61705528 CCAGCTCCATCTGCACCATCAGT No data
Right 1109391978 13:61705519-61705541 CACCATCAGTTTTCTTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109391978 Original CRISPR CACCATCAGTTTTCTTGGGT GGG Intergenic
No off target data available for this crispr