ID: 1109391982

View in Genome Browser
Species Human (GRCh38)
Location 13:61705553-61705575
Sequence CCAGCCCATACTGAAGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109391979_1109391982 9 Left 1109391979 13:61705521-61705543 CCATCAGTTTTCTTGGGTGGGTT No data
Right 1109391982 13:61705553-61705575 CCAGCCCATACTGAAGATTTTGG No data
1109391973_1109391982 24 Left 1109391973 13:61705506-61705528 CCAGCTCCATCTGCACCATCAGT No data
Right 1109391982 13:61705553-61705575 CCAGCCCATACTGAAGATTTTGG No data
1109391972_1109391982 25 Left 1109391972 13:61705505-61705527 CCCAGCTCCATCTGCACCATCAG No data
Right 1109391982 13:61705553-61705575 CCAGCCCATACTGAAGATTTTGG No data
1109391974_1109391982 18 Left 1109391974 13:61705512-61705534 CCATCTGCACCATCAGTTTTCTT No data
Right 1109391982 13:61705553-61705575 CCAGCCCATACTGAAGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109391982 Original CRISPR CCAGCCCATACTGAAGATTT TGG Intergenic
No off target data available for this crispr