ID: 1109396475

View in Genome Browser
Species Human (GRCh38)
Location 13:61766101-61766123
Sequence CCACCCGCAGCCAGACTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109396475_1109396491 26 Left 1109396475 13:61766101-61766123 CCTCTGAGTCTGGCTGCGGGTGG No data
Right 1109396491 13:61766150-61766172 GGGGCGGAGTGTGTGCTGATGGG No data
1109396475_1109396484 1 Left 1109396475 13:61766101-61766123 CCTCTGAGTCTGGCTGCGGGTGG No data
Right 1109396484 13:61766125-61766147 CAGGGTTGTTGGGCTTCGAGGGG No data
1109396475_1109396489 10 Left 1109396475 13:61766101-61766123 CCTCTGAGTCTGGCTGCGGGTGG No data
Right 1109396489 13:61766134-61766156 TGGGCTTCGAGGGGGCGGGGCGG No data
1109396475_1109396490 25 Left 1109396475 13:61766101-61766123 CCTCTGAGTCTGGCTGCGGGTGG No data
Right 1109396490 13:61766149-61766171 CGGGGCGGAGTGTGTGCTGATGG No data
1109396475_1109396480 -10 Left 1109396475 13:61766101-61766123 CCTCTGAGTCTGGCTGCGGGTGG No data
Right 1109396480 13:61766114-61766136 CTGCGGGTGGGCAGGGTTGTTGG No data
1109396475_1109396483 0 Left 1109396475 13:61766101-61766123 CCTCTGAGTCTGGCTGCGGGTGG No data
Right 1109396483 13:61766124-61766146 GCAGGGTTGTTGGGCTTCGAGGG No data
1109396475_1109396481 -9 Left 1109396475 13:61766101-61766123 CCTCTGAGTCTGGCTGCGGGTGG No data
Right 1109396481 13:61766115-61766137 TGCGGGTGGGCAGGGTTGTTGGG No data
1109396475_1109396487 6 Left 1109396475 13:61766101-61766123 CCTCTGAGTCTGGCTGCGGGTGG No data
Right 1109396487 13:61766130-61766152 TTGTTGGGCTTCGAGGGGGCGGG No data
1109396475_1109396485 2 Left 1109396475 13:61766101-61766123 CCTCTGAGTCTGGCTGCGGGTGG No data
Right 1109396485 13:61766126-61766148 AGGGTTGTTGGGCTTCGAGGGGG No data
1109396475_1109396488 7 Left 1109396475 13:61766101-61766123 CCTCTGAGTCTGGCTGCGGGTGG No data
Right 1109396488 13:61766131-61766153 TGTTGGGCTTCGAGGGGGCGGGG No data
1109396475_1109396486 5 Left 1109396475 13:61766101-61766123 CCTCTGAGTCTGGCTGCGGGTGG No data
Right 1109396486 13:61766129-61766151 GTTGTTGGGCTTCGAGGGGGCGG No data
1109396475_1109396482 -1 Left 1109396475 13:61766101-61766123 CCTCTGAGTCTGGCTGCGGGTGG No data
Right 1109396482 13:61766123-61766145 GGCAGGGTTGTTGGGCTTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109396475 Original CRISPR CCACCCGCAGCCAGACTCAG AGG (reversed) Intergenic
No off target data available for this crispr