ID: 1109404146

View in Genome Browser
Species Human (GRCh38)
Location 13:61875595-61875617
Sequence TCGCTATGTTGAGGGAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109404142_1109404146 8 Left 1109404142 13:61875564-61875586 CCATAAGAGAAAGGAAAATTTGT No data
Right 1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109404146 Original CRISPR TCGCTATGTTGAGGGAATGC TGG Intergenic
No off target data available for this crispr