ID: 1109406356

View in Genome Browser
Species Human (GRCh38)
Location 13:61905378-61905400
Sequence CTTATTATCAAACGTTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109406354_1109406356 10 Left 1109406354 13:61905345-61905367 CCATAGAGCTTTTTAAAAAATCC No data
Right 1109406356 13:61905378-61905400 CTTATTATCAAACGTTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109406356 Original CRISPR CTTATTATCAAACGTTAGCC AGG Intergenic
No off target data available for this crispr