ID: 1109421287 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:62115682-62115704 |
| Sequence | CTGGAGAATCAGATCACACC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1109421287_1109421293 | 0 | Left | 1109421287 | 13:62115682-62115704 | CCAGGTGTGATCTGATTCTCCAG | No data | ||
| Right | 1109421293 | 13:62115705-62115727 | GTACATCAAGGCAAGGACCCGGG | No data | ||||
| 1109421287_1109421292 | -1 | Left | 1109421287 | 13:62115682-62115704 | CCAGGTGTGATCTGATTCTCCAG | No data | ||
| Right | 1109421292 | 13:62115704-62115726 | GGTACATCAAGGCAAGGACCCGG | No data | ||||
| 1109421287_1109421290 | -7 | Left | 1109421287 | 13:62115682-62115704 | CCAGGTGTGATCTGATTCTCCAG | No data | ||
| Right | 1109421290 | 13:62115698-62115720 | TCTCCAGGTACATCAAGGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1109421287 | Original CRISPR | CTGGAGAATCAGATCACACC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||