ID: 1109421287

View in Genome Browser
Species Human (GRCh38)
Location 13:62115682-62115704
Sequence CTGGAGAATCAGATCACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109421287_1109421293 0 Left 1109421287 13:62115682-62115704 CCAGGTGTGATCTGATTCTCCAG No data
Right 1109421293 13:62115705-62115727 GTACATCAAGGCAAGGACCCGGG No data
1109421287_1109421292 -1 Left 1109421287 13:62115682-62115704 CCAGGTGTGATCTGATTCTCCAG No data
Right 1109421292 13:62115704-62115726 GGTACATCAAGGCAAGGACCCGG No data
1109421287_1109421290 -7 Left 1109421287 13:62115682-62115704 CCAGGTGTGATCTGATTCTCCAG No data
Right 1109421290 13:62115698-62115720 TCTCCAGGTACATCAAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109421287 Original CRISPR CTGGAGAATCAGATCACACC TGG (reversed) Intergenic
No off target data available for this crispr