ID: 1109424282

View in Genome Browser
Species Human (GRCh38)
Location 13:62150982-62151004
Sequence CCCTTTAAGCTGTAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109424274_1109424282 -2 Left 1109424274 13:62150961-62150983 CCCCAGGCTATTGGTTATGTCCC No data
Right 1109424282 13:62150982-62151004 CCCTTTAAGCTGTAGGTGGAGGG No data
1109424269_1109424282 16 Left 1109424269 13:62150943-62150965 CCAAGGGACCATAAAAACCCCCA No data
Right 1109424282 13:62150982-62151004 CCCTTTAAGCTGTAGGTGGAGGG No data
1109424276_1109424282 -4 Left 1109424276 13:62150963-62150985 CCAGGCTATTGGTTATGTCCCCT 0: 21
1: 52
2: 49
3: 45
4: 145
Right 1109424282 13:62150982-62151004 CCCTTTAAGCTGTAGGTGGAGGG No data
1109424275_1109424282 -3 Left 1109424275 13:62150962-62150984 CCCAGGCTATTGGTTATGTCCCC No data
Right 1109424282 13:62150982-62151004 CCCTTTAAGCTGTAGGTGGAGGG No data
1109424271_1109424282 8 Left 1109424271 13:62150951-62150973 CCATAAAAACCCCCAGGCTATTG No data
Right 1109424282 13:62150982-62151004 CCCTTTAAGCTGTAGGTGGAGGG No data
1109424273_1109424282 -1 Left 1109424273 13:62150960-62150982 CCCCCAGGCTATTGGTTATGTCC No data
Right 1109424282 13:62150982-62151004 CCCTTTAAGCTGTAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109424282 Original CRISPR CCCTTTAAGCTGTAGGTGGA GGG Intergenic
No off target data available for this crispr