ID: 1109430574

View in Genome Browser
Species Human (GRCh38)
Location 13:62229072-62229094
Sequence GATACCTGGCCAATACGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109430574_1109430578 28 Left 1109430574 13:62229072-62229094 CCTTGTCGTATTGGCCAGGTATC No data
Right 1109430578 13:62229123-62229145 TAATTGAAAGAGAATAGTCTGGG No data
1109430574_1109430577 27 Left 1109430574 13:62229072-62229094 CCTTGTCGTATTGGCCAGGTATC No data
Right 1109430577 13:62229122-62229144 ATAATTGAAAGAGAATAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109430574 Original CRISPR GATACCTGGCCAATACGACA AGG (reversed) Intergenic
No off target data available for this crispr