ID: 1109432506

View in Genome Browser
Species Human (GRCh38)
Location 13:62253647-62253669
Sequence CCTAACATCCACAATCTTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109432506_1109432512 8 Left 1109432506 13:62253647-62253669 CCGTAAAGATTGTGGATGTTAGG No data
Right 1109432512 13:62253678-62253700 CAGGTAATCTTAATAGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109432506 Original CRISPR CCTAACATCCACAATCTTTA CGG (reversed) Intergenic
No off target data available for this crispr