ID: 1109436657

View in Genome Browser
Species Human (GRCh38)
Location 13:62312292-62312314
Sequence CTTGATGCCCTCAGAATACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109436652_1109436657 27 Left 1109436652 13:62312242-62312264 CCTTATCATTACCTACTATTTTG No data
Right 1109436657 13:62312292-62312314 CTTGATGCCCTCAGAATACCAGG No data
1109436656_1109436657 4 Left 1109436656 13:62312265-62312287 CCAGGAGTTTGGCTATATTTACA No data
Right 1109436657 13:62312292-62312314 CTTGATGCCCTCAGAATACCAGG No data
1109436654_1109436657 16 Left 1109436654 13:62312253-62312275 CCTACTATTTTGCCAGGAGTTTG No data
Right 1109436657 13:62312292-62312314 CTTGATGCCCTCAGAATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109436657 Original CRISPR CTTGATGCCCTCAGAATACC AGG Intergenic
No off target data available for this crispr