ID: 1109440499

View in Genome Browser
Species Human (GRCh38)
Location 13:62365277-62365299
Sequence CTACACAGTGAGTCTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109440499_1109440501 18 Left 1109440499 13:62365277-62365299 CCAACAAAAGACTCACTGTGTAG No data
Right 1109440501 13:62365318-62365340 CCACCTGTTGCTCCCAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109440499 Original CRISPR CTACACAGTGAGTCTTTTGT TGG (reversed) Intergenic
No off target data available for this crispr