ID: 1109446954

View in Genome Browser
Species Human (GRCh38)
Location 13:62452729-62452751
Sequence ATATTTCAACACATCTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109446952_1109446954 10 Left 1109446952 13:62452696-62452718 CCCTCATAGCAATTTGATTTTTT No data
Right 1109446954 13:62452729-62452751 ATATTTCAACACATCTACATAGG No data
1109446953_1109446954 9 Left 1109446953 13:62452697-62452719 CCTCATAGCAATTTGATTTTTTA No data
Right 1109446954 13:62452729-62452751 ATATTTCAACACATCTACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109446954 Original CRISPR ATATTTCAACACATCTACAT AGG Intergenic
No off target data available for this crispr