ID: 1109449730

View in Genome Browser
Species Human (GRCh38)
Location 13:62495272-62495294
Sequence CCATCAGTATTATAGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109449724_1109449730 26 Left 1109449724 13:62495223-62495245 CCAAATGACATTTTCACAAAGTT No data
Right 1109449730 13:62495272-62495294 CCATCAGTATTATAGGAAATGGG No data
1109449725_1109449730 -6 Left 1109449725 13:62495255-62495277 CCTGTATTACGTCCTTTCCATCA No data
Right 1109449730 13:62495272-62495294 CCATCAGTATTATAGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109449730 Original CRISPR CCATCAGTATTATAGGAAAT GGG Intergenic
No off target data available for this crispr