ID: 1109453579

View in Genome Browser
Species Human (GRCh38)
Location 13:62551805-62551827
Sequence TGCTGTGTCCCGAAGTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109453579_1109453584 16 Left 1109453579 13:62551805-62551827 CCTCTTCACTTCGGGACACAGCA No data
Right 1109453584 13:62551844-62551866 TTAGGATTCCCATAATGGGGTGG No data
1109453579_1109453582 12 Left 1109453579 13:62551805-62551827 CCTCTTCACTTCGGGACACAGCA No data
Right 1109453582 13:62551840-62551862 AATGTTAGGATTCCCATAATGGG No data
1109453579_1109453581 11 Left 1109453579 13:62551805-62551827 CCTCTTCACTTCGGGACACAGCA No data
Right 1109453581 13:62551839-62551861 GAATGTTAGGATTCCCATAATGG No data
1109453579_1109453583 13 Left 1109453579 13:62551805-62551827 CCTCTTCACTTCGGGACACAGCA No data
Right 1109453583 13:62551841-62551863 ATGTTAGGATTCCCATAATGGGG No data
1109453579_1109453585 17 Left 1109453579 13:62551805-62551827 CCTCTTCACTTCGGGACACAGCA No data
Right 1109453585 13:62551845-62551867 TAGGATTCCCATAATGGGGTGGG No data
1109453579_1109453580 -2 Left 1109453579 13:62551805-62551827 CCTCTTCACTTCGGGACACAGCA No data
Right 1109453580 13:62551826-62551848 CAAAGATGTCTTAGAATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109453579 Original CRISPR TGCTGTGTCCCGAAGTGAAG AGG (reversed) Intergenic
No off target data available for this crispr