ID: 1109453585

View in Genome Browser
Species Human (GRCh38)
Location 13:62551845-62551867
Sequence TAGGATTCCCATAATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109453579_1109453585 17 Left 1109453579 13:62551805-62551827 CCTCTTCACTTCGGGACACAGCA No data
Right 1109453585 13:62551845-62551867 TAGGATTCCCATAATGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109453585 Original CRISPR TAGGATTCCCATAATGGGGT GGG Intergenic
No off target data available for this crispr