ID: 1109456851

View in Genome Browser
Species Human (GRCh38)
Location 13:62604063-62604085
Sequence CTCCCCAGGGAGAAACTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109456842_1109456851 22 Left 1109456842 13:62604018-62604040 CCTTGGAAAAGTTGGGACATTGA No data
Right 1109456851 13:62604063-62604085 CTCCCCAGGGAGAAACTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109456851 Original CRISPR CTCCCCAGGGAGAAACTGGG AGG Intergenic
No off target data available for this crispr