ID: 1109458654

View in Genome Browser
Species Human (GRCh38)
Location 13:62626348-62626370
Sequence TGTGTCTAAAAGACCGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109458648_1109458654 1 Left 1109458648 13:62626324-62626346 CCATTAAAGCTTTTGCCTCTTTC No data
Right 1109458654 13:62626348-62626370 TGTGTCTAAAAGACCGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109458654 Original CRISPR TGTGTCTAAAAGACCGAGGG GGG Intergenic
No off target data available for this crispr