ID: 1109462884

View in Genome Browser
Species Human (GRCh38)
Location 13:62686933-62686955
Sequence CCACCTAATCAGCTCTGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109462880_1109462884 -4 Left 1109462880 13:62686914-62686936 CCCTCAGTCTGGGCGGGCACCAC No data
Right 1109462884 13:62686933-62686955 CCACCTAATCAGCTCTGGCATGG No data
1109462879_1109462884 -1 Left 1109462879 13:62686911-62686933 CCACCCTCAGTCTGGGCGGGCAC No data
Right 1109462884 13:62686933-62686955 CCACCTAATCAGCTCTGGCATGG No data
1109462878_1109462884 0 Left 1109462878 13:62686910-62686932 CCCACCCTCAGTCTGGGCGGGCA No data
Right 1109462884 13:62686933-62686955 CCACCTAATCAGCTCTGGCATGG No data
1109462881_1109462884 -5 Left 1109462881 13:62686915-62686937 CCTCAGTCTGGGCGGGCACCACC No data
Right 1109462884 13:62686933-62686955 CCACCTAATCAGCTCTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109462884 Original CRISPR CCACCTAATCAGCTCTGGCA TGG Intergenic
No off target data available for this crispr