ID: 1109463099

View in Genome Browser
Species Human (GRCh38)
Location 13:62690102-62690124
Sequence TTTACCAAACATAACTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109463096_1109463099 16 Left 1109463096 13:62690063-62690085 CCTTCTAAGGGCTTTGCAATGCA No data
Right 1109463099 13:62690102-62690124 TTTACCAAACATAACTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109463099 Original CRISPR TTTACCAAACATAACTTGGT AGG Intergenic
No off target data available for this crispr