ID: 1109464352

View in Genome Browser
Species Human (GRCh38)
Location 13:62709873-62709895
Sequence TTGGCTAATTGCCCTTGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109464349_1109464352 8 Left 1109464349 13:62709842-62709864 CCTTGACTATTTTGATGTCTTTT No data
Right 1109464352 13:62709873-62709895 TTGGCTAATTGCCCTTGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109464352 Original CRISPR TTGGCTAATTGCCCTTGTTA GGG Intergenic
No off target data available for this crispr