ID: 1109466257

View in Genome Browser
Species Human (GRCh38)
Location 13:62736058-62736080
Sequence CAAGTGGCCCACATAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109466252_1109466257 4 Left 1109466252 13:62736031-62736053 CCTTTATTTCATAAAAATTGGCC No data
Right 1109466257 13:62736058-62736080 CAAGTGGCCCACATAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109466257 Original CRISPR CAAGTGGCCCACATAGAACA TGG Intergenic
No off target data available for this crispr