ID: 1109469546

View in Genome Browser
Species Human (GRCh38)
Location 13:62787785-62787807
Sequence TGGAACTCTTGGGGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109469538_1109469546 12 Left 1109469538 13:62787750-62787772 CCCACATGAGAGAATGCAAGATA No data
Right 1109469546 13:62787785-62787807 TGGAACTCTTGGGGGAAAACAGG No data
1109469539_1109469546 11 Left 1109469539 13:62787751-62787773 CCACATGAGAGAATGCAAGATAT No data
Right 1109469546 13:62787785-62787807 TGGAACTCTTGGGGGAAAACAGG No data
1109469537_1109469546 24 Left 1109469537 13:62787738-62787760 CCACTCTTGATACCCACATGAGA No data
Right 1109469546 13:62787785-62787807 TGGAACTCTTGGGGGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109469546 Original CRISPR TGGAACTCTTGGGGGAAAAC AGG Intergenic
No off target data available for this crispr