ID: 1109479287

View in Genome Browser
Species Human (GRCh38)
Location 13:62928158-62928180
Sequence AACTGCTTGTAGAATTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109479275_1109479287 29 Left 1109479275 13:62928106-62928128 CCTAGCTGCAGGAGACCCCATGA 0: 12
1: 30
2: 50
3: 120
4: 278
Right 1109479287 13:62928158-62928180 AACTGCTTGTAGAATTGGCAGGG No data
1109479278_1109479287 12 Left 1109479278 13:62928123-62928145 CCATGATCCCTAGAGACATTTGA No data
Right 1109479287 13:62928158-62928180 AACTGCTTGTAGAATTGGCAGGG No data
1109479280_1109479287 5 Left 1109479280 13:62928130-62928152 CCCTAGAGACATTTGAGCTGGTA No data
Right 1109479287 13:62928158-62928180 AACTGCTTGTAGAATTGGCAGGG No data
1109479281_1109479287 4 Left 1109479281 13:62928131-62928153 CCTAGAGACATTTGAGCTGGTAG No data
Right 1109479287 13:62928158-62928180 AACTGCTTGTAGAATTGGCAGGG No data
1109479276_1109479287 14 Left 1109479276 13:62928121-62928143 CCCCATGATCCCTAGAGACATTT No data
Right 1109479287 13:62928158-62928180 AACTGCTTGTAGAATTGGCAGGG No data
1109479277_1109479287 13 Left 1109479277 13:62928122-62928144 CCCATGATCCCTAGAGACATTTG No data
Right 1109479287 13:62928158-62928180 AACTGCTTGTAGAATTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109479287 Original CRISPR AACTGCTTGTAGAATTGGCA GGG Intergenic
No off target data available for this crispr