ID: 1109482872

View in Genome Browser
Species Human (GRCh38)
Location 13:62979305-62979327
Sequence TAAATCAATACAGAGTAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109482872_1109482875 21 Left 1109482872 13:62979305-62979327 CCACCTTACTCTGTATTGATTTA No data
Right 1109482875 13:62979349-62979371 TTCATCATCCTACAGAACATCGG No data
1109482872_1109482876 26 Left 1109482872 13:62979305-62979327 CCACCTTACTCTGTATTGATTTA No data
Right 1109482876 13:62979354-62979376 CATCCTACAGAACATCGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109482872 Original CRISPR TAAATCAATACAGAGTAAGG TGG (reversed) Intergenic