ID: 1109482875 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:62979349-62979371 |
Sequence | TTCATCATCCTACAGAACAT CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1109482873_1109482875 | 18 | Left | 1109482873 | 13:62979308-62979330 | CCTTACTCTGTATTGATTTATTT | No data | ||
Right | 1109482875 | 13:62979349-62979371 | TTCATCATCCTACAGAACATCGG | No data | ||||
1109482872_1109482875 | 21 | Left | 1109482872 | 13:62979305-62979327 | CCACCTTACTCTGTATTGATTTA | No data | ||
Right | 1109482875 | 13:62979349-62979371 | TTCATCATCCTACAGAACATCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1109482875 | Original CRISPR | TTCATCATCCTACAGAACAT CGG | Intergenic | ||