ID: 1109498783

View in Genome Browser
Species Human (GRCh38)
Location 13:63211343-63211365
Sequence TTGAAAATACATATGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109498781_1109498783 -9 Left 1109498781 13:63211329-63211351 CCGTTTTATTCATATTGAAAATA No data
Right 1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG No data
1109498779_1109498783 12 Left 1109498779 13:63211308-63211330 CCTCTGCTCAAAGCACTCATCCC No data
Right 1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG No data
1109498780_1109498783 -8 Left 1109498780 13:63211328-63211350 CCCGTTTTATTCATATTGAAAAT No data
Right 1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109498783 Original CRISPR TTGAAAATACATATGGAAAA TGG Intergenic
No off target data available for this crispr