ID: 1109498783 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:63211343-63211365 |
| Sequence | TTGAAAATACATATGGAAAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1109498781_1109498783 | -9 | Left | 1109498781 | 13:63211329-63211351 | CCGTTTTATTCATATTGAAAATA | No data | ||
| Right | 1109498783 | 13:63211343-63211365 | TTGAAAATACATATGGAAAATGG | No data | ||||
| 1109498779_1109498783 | 12 | Left | 1109498779 | 13:63211308-63211330 | CCTCTGCTCAAAGCACTCATCCC | No data | ||
| Right | 1109498783 | 13:63211343-63211365 | TTGAAAATACATATGGAAAATGG | No data | ||||
| 1109498780_1109498783 | -8 | Left | 1109498780 | 13:63211328-63211350 | CCCGTTTTATTCATATTGAAAAT | No data | ||
| Right | 1109498783 | 13:63211343-63211365 | TTGAAAATACATATGGAAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1109498783 | Original CRISPR | TTGAAAATACATATGGAAAA TGG | Intergenic | ||
| No off target data available for this crispr | |||||