ID: 1109501994

View in Genome Browser
Species Human (GRCh38)
Location 13:63249913-63249935
Sequence AACTGCCGAGGGTCTTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109501983_1109501994 28 Left 1109501983 13:63249862-63249884 CCACCTTACCCCACAAGTGTTTA No data
Right 1109501994 13:63249913-63249935 AACTGCCGAGGGTCTTGCCTGGG No data
1109501986_1109501994 19 Left 1109501986 13:63249871-63249893 CCCACAAGTGTTTATGCCAGATG No data
Right 1109501994 13:63249913-63249935 AACTGCCGAGGGTCTTGCCTGGG No data
1109501985_1109501994 20 Left 1109501985 13:63249870-63249892 CCCCACAAGTGTTTATGCCAGAT No data
Right 1109501994 13:63249913-63249935 AACTGCCGAGGGTCTTGCCTGGG No data
1109501987_1109501994 18 Left 1109501987 13:63249872-63249894 CCACAAGTGTTTATGCCAGATGA No data
Right 1109501994 13:63249913-63249935 AACTGCCGAGGGTCTTGCCTGGG No data
1109501988_1109501994 3 Left 1109501988 13:63249887-63249909 CCAGATGATTTTGTGCAGATAAG No data
Right 1109501994 13:63249913-63249935 AACTGCCGAGGGTCTTGCCTGGG No data
1109501984_1109501994 25 Left 1109501984 13:63249865-63249887 CCTTACCCCACAAGTGTTTATGC No data
Right 1109501994 13:63249913-63249935 AACTGCCGAGGGTCTTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109501994 Original CRISPR AACTGCCGAGGGTCTTGCCT GGG Intergenic
No off target data available for this crispr