ID: 1109519023

View in Genome Browser
Species Human (GRCh38)
Location 13:63484812-63484834
Sequence GACAGCTCTTGGCTTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109519020_1109519023 8 Left 1109519020 13:63484781-63484803 CCTTCTGCAGAAAACTATTCTCC No data
Right 1109519023 13:63484812-63484834 GACAGCTCTTGGCTTGTTACTGG No data
1109519019_1109519023 11 Left 1109519019 13:63484778-63484800 CCACCTTCTGCAGAAAACTATTC No data
Right 1109519023 13:63484812-63484834 GACAGCTCTTGGCTTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109519023 Original CRISPR GACAGCTCTTGGCTTGTTAC TGG Intergenic
No off target data available for this crispr