ID: 1109523589

View in Genome Browser
Species Human (GRCh38)
Location 13:63545146-63545168
Sequence CGGCCAACAGCACTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109523582_1109523589 23 Left 1109523582 13:63545100-63545122 CCTGCTGGATCTGGAGGGATGGA No data
Right 1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG No data
1109523580_1109523589 24 Left 1109523580 13:63545099-63545121 CCCTGCTGGATCTGGAGGGATGG No data
Right 1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109523589 Original CRISPR CGGCCAACAGCACTGGTGGA TGG Intergenic
No off target data available for this crispr