ID: 1109525361

View in Genome Browser
Species Human (GRCh38)
Location 13:63567293-63567315
Sequence AAGGGTGAGCAGAGTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109525361_1109525371 28 Left 1109525361 13:63567293-63567315 CCCTCACCACTCTGCTCACCCTT No data
Right 1109525371 13:63567344-63567366 CAAGCCGAGCACAGCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109525361 Original CRISPR AAGGGTGAGCAGAGTGGTGA GGG (reversed) Intergenic
No off target data available for this crispr